Research Article

Insulin inhibits autophagy signaling independent of counterregulatory hormone levels but does not affect the effects of exercise

Abstract

Acute exercise increases autophagic signaling through Unc-51 like kinase-1 (ULK1) in human skeletal muscle during both anabolic and catabolic conditions. The aim of the present study was to investigate if changes in ULK1 Ser555 phosphorylation during exercise are reflected by changes in phosphorylation of a newly identified ULK1 substrate (ATG14 Ser29) and to elucidate the involvement of circulatory hormones in the regulation of autophagy in human skeletal muscle. We show that 1 h of cycling exercise increases ATG14 Ser29 phosphorylation during both hyperinsulinemic euglycemic and euinsulinemic euglycemic conditions. This could suggest that counterregulatory hormones stimulate autophagy in skeletal muscle, as circulating concentrations of these hormones are highly elevated during exercise. Furthermore, ATG14 Ser29 correlated positively with ULK1 phosphorylation, suggesting that ULK1 Ser555 (activating site) phosphorylation reflects ULK1 kinase activity. In a separate series of experiments, we show that insulin stimulates ULK1 phosphorylation at Ser757 (inhibitory site) in both hypoglycemic and euglycemic conditions, suggesting that counterregulatory hormones (such as epinephrine, norepinephrine, growth hormone, and glucagon) have limited effects on autophagy signaling in human skeletal muscle. In conclusion, 1 h of cycling exercise increases phosphorylation of ATG14 at Ser29 in a pattern that mirrors ULK1 phosphorylation at Ser555. Moreover, insulin effects on autophagy signaling in human skeletal muscle are independent of hypoglycemic and euglycemic conditions.

NEW & NOTEWORTHY Autophagy signaling is regulated in a hierarchical order by exercise, insulin, and counterregulatory hormones. Exercise-induced autophagy signaling is stimulated by local factors in skeletal muscle rather than circulatory hormones. Unc-51 like kinase-1 (ULK1) phosphorylation at Ser555 reflects ULK1 kinase activity.

INTRODUCTION

Autophagy is a cellular recycling process that regulates cellular homeostasis by delivering damaged proteins and organelles to lysosomes for degradation (18). Autophagy is stimulated during exercise in human skeletal muscle (5, 16). Studies in transgenic mouse models demonstrate that autophagy is required for improvements in exercise capacity and for protective effects of exercise training against impaired glucose tolerance (7, 12). Thus, autophagy serves as an integrated response to exercise in skeletal muscle and plays a critical role in adaptation to exercise training.

AMP-activated protein kinase is an energy-sensitive enzyme that promotes autophagy by activating Unc-51 like kinase-1 (ULK1) through phosphorylation at Ser555 in energy-scarce conditions (10). Conversely, mammalian target of rapamycin (mTOR) complex 1 is a hormone- and nutrient-sensitive enzyme that inhibits autophagy through phosphorylation of ULK1 at Ser757 in energy-rich conditions (9, 10). ULK1 regulates the conversion of microtubule-associated protein 1 light chain 3 (LC3)-I to its lipidated form (LC3-II), subsequent incorporation into the autophagosomal membrane, and, ultimately, degradation in lysosomes (24). ULK1 is the only enzyme with kinase activity among autophagy-related proteins (8), but intermediary events linking ULK1 phosphorylation to LC3B conversion remains incompletely understood. Recently, a number of ULK1 substrates were identified in vitro, and the majority of these substrates belong to the class-III phosphatidylinositol 3-kinase complex that produces and supplies the expanding autophagosomes with phospholipids (3). Among these sites are the specific residues ATG14 Ser29 and BECLIN-1 Ser15 (3, 20). Regulation of these substrates remains to be documented in humans. Such knowledge is of principal interest, as it provides a more complete image of the pathway and gives more opportunities for future development of exercise mimetic drugs.

Exercise represents a major metabolic stimulus to the human body and gives rise to local as well as systemic adaptations that serve to cover the metabolic demands and enable cellular remodeling (2, 17). We have previously shown that 1 h of cycling exercise increases autophagy signaling during both high and low insulin levels (16). These findings demonstrate that the effects of exercise exceed inhibitory effects of insulin. Moreover, they indicate that hormones counterregulating the glucose-lowering insulin, such as catecholamines and growth hormone, could have potent stimulatory effects on autophagy in human skeletal muscle, as circulating concentrations of these hormones are highly elevated during exercise in both euinsulinemic and hyperinsulinemic conditions (6, 16, 21). However, the effects of counterregulatory hormones on the regulation of autophagy in skeletal muscle remains to be established.

The aim of the present study was to investigate if changes in ULK1 Ser555 phosphorylation during exercise are reflected by changes in phosphorylation of ATG14 at Ser29 and BECLIN-1 at Ser15 and to elucidate hormonal regulation of autophagy in human skeletal muscle. We hypothesized that phosphorylation of ATG14 Ser29 and BECLIN-1 Ser15 increase during exercise and that counterregulatory hormones are involved in the regulation of autophagy signaling in skeletal muscle.

METHODS

Acute exercise study.

Skeletal muscle samples from 8 healthy young men [mean (range): 27 (24–35) yr; BMI of 24 (23–29) kg/cm2; peak oxygen uptake (V̇o2max) of 4,082 (3,146–4,732) ml/min] participating in a randomized crossover study were analyzed. ULK1 signaling in these samples has previously been established (16). Therefore, samples from this study were found suitable for the investigation of ULK1 substrates. As previously described, the subjects completed an incremental cycle ergometer test to determine V̇o2max. We used this test to determine the intensity corresponding to 50% of V̇o2max for each subject. After the initial baseline testing, subjects completed 2 single bouts of cycling exercise at 50% V̇o2max for 60 min; one bout was performed with simultaneous infusion of glucose (glucose infusion day), and the other bout was performed following a 36-h fasting period (fasting day). The glucose infusion was started after sampling of the first biopsy with a rate of 0.2 g·kg−1·min−1, then increased to 1 g·kg−1·min−1 during exercise and finally lowered to 0.2 g·kg−1·min−1 in the recovery period. The order of the two experimental days were randomized and separated by approximately one month. Skeletal muscle biopsies and blood were sampled 1 h before the single bout of exercise, immediately after exercise, and 30 min into the recovery period. The biopsies were sampled from vastus lateralis using a Bergstrom needle after local anesthesia and immediately frozen in liquid nitrogen and stored in −80°C until analysis. The study was approved by the local scientific ethics committee (j. no. 20090026) and performed in accordance with the Declaration of Helsinki. All participants gave written informed consent to participate in the study.

Acute hypoglycemia study.

Skeletal muscle samples were analyzed from 9 healthy young men [mean (range): 22 (18–27) yr; BMI of 23 (22–26) kg/cm2] participating in a randomized crossover study that has been published previously (23). As previously described, participants were examined at 3 experimental days separated by approximately 3 wk. At one occasion, hyperinsulinemic hypoglycemia was induced by an intravenous infusion of a bolus of insulin (0.1 IU Actrapid/kg in 2 ml NaCl). At another occasion, hyperinsulinemic euglycemia was induced by an intravenous infusion of a bolus of insulin (0.1 IU Actrapid/kg in 2 ml NaCl) together with glucose (varying amounts to keep a stable blood glucose concentration). As a control, a bolus of NaCl was infused intravenously at a third occasion. Skeletal muscle biopsies and blood were sampled from separate incision sites before (t = 0 min), as well as 30 min after (t = 30 min) and 75 min after (t = 75 min) insulin or saline infusion. Muscle biopsies were sampled from vastus lateralis using a Bergstrom needle after local anesthesia and immediately frozen in liquid nitrogen and stored in −80°C until analysis. The study was approved by the local scientific ethics committee (1–10–72–113–13) and performed in accordance with the Declaration of Helsinki. All participants gave written informed consent to participate in the study.

Protein extraction and Western blot analysis.

Skeletal muscle samples were prepared as previously described in a lysis buffer containing 50 mM HEPES, 137 mM NaCl, 10 mM Na4P2O7, 10 mM NaF, 2 mM EDTA, 1 mM MgCl2, 1 mM CaCl2, 2 mM Na3VO4, 1% (vol/vol) NP-40, 10% (vol/vol) glycerol, 3 mg/ml aprotinin, 5 mg/ml leupeptin, 0.5 µg/ml pepstatin, 10 µg/ml antipain, 1.5 mg/ml benzamidine, and 100 µM 4-(−2-aminoethyl)-benzenesulfyl fluoride, pH 7.4. Western blot analysis was used to measure the expression and phosphorylation of selected proteins. The following antibodies were used: from Cell Signaling Technology (MA): ULK1 (cat. no. 4773), p-ULK1 Ser555 (cat. no. 5869), p-ULK1 Ser757 (cat. no. 6888), mTOR (cat. no. 2972), p-mTOR Ser2448 (cat. no. 2971), LC3B (cat. no. 3868), BECLIN-1 (cat. no. 3495), p-BECLIN1 Ser15 (cat. no. 84966), p-ATG14 Ser29 (cat. no. 13155), ATG14 (cat. no. 96752); from Abbiotac: p-BECLIN-1 Ser15 (cat. no. 254515); from Abcam (Cambridge, UK): p62 (cat. no. ab56416); and from Santa Cruz Biotechnology (CA): secondary goat anti-rabbit IgG horseradish peroxidase-conjugated (cat. no. sc-2054) and secondary chicken anti-mouse IgG horseradish peroxidase-conjugated (cat. no. sc-2962). Control for equal loading was performed using the Stain-Free technology. Proteins were visualized by chemiluminescence (Pierce SuperSignal West Dura, Thermo Fisher Scientific, IL) and quantified with the ChemiDoc MP Imaging System (Bio-Rad). Protein Plus Precision All Blue standards were used as markers of molecular weight (Bio-Rad).

RNA extraction and RT-PCR analysis.

The transcription of selected genes was analyzed in the acute hypoglycemia study. RNA was extracted from freeze-dried muscle tissue using TRIzol (Gibco BRL/Life Technologies, Roskilde, Denmark) using a mixer mill. The polymerase chain reactions were performed in duplicate using a LightCycler SYBR Green Master Mix in a LightCycler 480 (Roche Applied Science, Penzberg, Germany). β2 microglobulin was equally expressed in all experimental groups and used as a housekeeping gene. The following primers were used: β2 microglobulin (111 bp) GAGGCTATCCAGCGTACTCC and AATGTCGGATGGATGAAACCC, LC3B (76 bp) GTGCCTGTGTTGTTACGGAAAGC and TGTGTTTCTCCCGCTGTACTCC, and p62/SQSTM1 (150 bp) AGAAGAGCAGCTCACAGCCAAG and TATCCGACTCCATCTGTTCCTCAG.

Statistics.

The effects of time and intervention, and their interactions on dependent variables, were analyzed using a mixed-effect two-way ANOVA. When a significant interaction or main effect was observed, a linear comparison was used to evaluate differences within and between groups. Bonferroni correction was used to compensate for multiple testing. Repeated measurements were included in the model when appropriate. Pearson correlation and simple linear regression were used to analyze the association between protein phosphorylation levels. Individual data from all time points were included in the correlation analyses. Data are presented as mean ± SE. Normal distribution was assumed following evaluation of QQ-plots and histograms. Data were analyzed in Stata (Stata 12.1, StataCorp LP, TX), and graphs were prepared in SigmaPlot (SigmaPlot 11.0, CA).

RESULTS

Physical exercise increases phosphorylation of ATG14 Ser29 in human skeletal muscle.

Cycling exercise (1 h) at 50% V̇o2max increased phosphorylation of ATG14 at Ser29 by ~100%, followed by a slight decrease toward baseline 30 min into the recovery period (Fig. 1A). No change in protein expression of ATG14 was observed (Fig. 1B). ATG14 phosphorylation at Ser29 correlated positively with ULK1 phosphorylation at Ser555 (Fig. 1C). We were not able to detect the phosphorylation of a separate ULK1 substrate (BECLIN-1 Ser15) using the specified antibodies.

Fig. 1.

Fig. 1.Exercise-induced phosphorylation of ATG14 at Ser29 in human skeletal muscle correlates positively with Unc-51 like kinase-1 (ULK1) phosphorylation at Ser555. ATG14 phosphorylation at Ser29 increased after physical exercise in conditions with high and low insulin (A) and correlated positively with ULK1 phosphorylation at Ser555 (B). Physical exercise did not change the expression of ATG14 (C). Values are means ± SE. P values indicate main effect of time (exercise) based on a mixed-effect two-way ANOVA or a significant Pearson correlation. *Post hoc test for main effect of time shows significant difference from preexercise (−60 min). All time points and samples were included in the correlation analysis. Representative Western bots (D). Based on the applied molecular standards, approximated molecular weights are depicted on the right. AU, arbitrary units.


Insulin regulates autophagy signaling in human skeletal muscle similarly in hypoglycemic and euglycemic conditions.

Insulin decreased protein expression of ULK1 30 min after injection by ~50%, but we did not observe any difference between hypoglycemic and euglycemic conditions (Fig. 2A). This was associated with ~150% increased phosphorylation of ULK1 at Ser757 when expressed as a ratio of ULK1 (Fig. 2B) and ~50% increased phosphorylation when expressed as a ratio of total Stain Free protein (Fig. 2C). ULK1 Ser757 and mTOR Ser2448 phosphorylation were positively correlated (Fig. 2D). Insulin did not change ULK1 phosphorylation at Ser555 (Fig. 2E) or ATG14 phosphorylation at Ser29 (Fig. 2F). Protein expression of ATG14 remained unchanged (data not shown). Insulin decreased protein expression of LC3B-II 30 min after injection by ~50% without any difference between hypoglycemic and euglycemic conditions (Fig. 2G). Insulin did not change protein expression of LC3B-I and p62 (Fig. 2, HI).

Fig. 2.

Fig. 2.Insulin increases Unc-51 like kinase-1 (ULK1) phosphorylation at Ser757 in human skeletal muscle in hypoglycemic and euglycemic conditions. Insulin decreased protein expression of ULK1 (A) and increased ULK1 phosphorylation at Ser757 (B and C) in hypoglycemic and euglycemic conditions. ULK1 phosphorylation at Ser757 correlated positively with mammalian target of rapamycin (mTOR) phosphorylation at Ser2448 (D). Insulin did not change phosphorylation of ULK1 at Ser555 (E) or phosphorylation of ATG14 at Ser29 (F). LC3B-II decreased after insulin administration (G), whereas LC3B-I (H) and p62 (I) remained unchanged. Values are means ± SE. P values indicate main effect of time (exercise) based on a mixed-effect two-way ANOVA or a significant Pearson correlation. *Post hoc test for main effect of time shows significant difference from preexercise (−60 min). All time points and samples were included in the correlation analysis. Representative Western bots (J). Based on the applied molecular standards, approximated molecular weights are depicted on the right. AU, arbitrary units; CTR, control; hyperinsulinemic euglycemia; HH, hyperinsulinemic hypoglycemia.


Insulin does not regulate autophagy-related gene expression in human skeletal muscle during hypoglycemic and euglycemic conditions.

Insulin did not change gene expression of LC3B and p62 in hypoglycemic and euglycemic conditions compared with the control condition (Fig. 3, A and B).

Fig. 3.

Fig. 3.Insulin does not change gene expression of LC3B and p62 in human skeletal muscle in hypoglycemic and euglycemic conditions. Gene expression of LC3B (A) and p62 (B) did not change during insulin stimulation in hypoglycemic and euglycemic conditions. Values are means ± SE.


DISCUSSION

We have previously shown that autophagic signaling through ULK1 is stimulated during physical activity in human skeletal muscle in both hyperinsulinemic euglycemic and euinsulinemic euglycemic conditions (15). Now, we extend this finding by showing that phosphorylation of the downstream protein ATG14 at Ser29 correlates with ULK1 Ser555 phosphorylation, suggesting that ULK1 Ser555 phosphorylation indeed reflects ULK1 kinase activity. Moreover, we show that insulin’s effects on autophagy signaling is independent on hypoglycemic and euglycemic conditions, indicating that counterregulatory hormones have limited effects on autophagy signaling in human skeletal muscle. This suggests that autophagy is stimulated by local rather than circulatory factors during physical exercise.

One hour of cycling exercise increased phosphorylation of ATG14 at Ser29 in human skeletal muscle. Studies in cultured cells and rodents have recently documented that ULK1 possess the capacity to phosphorylate ATG14 at this specific site (3). Our data suggest that this molecular link remains intact in humans, as ATG14 at Ser29 phosphorylation correlated positively with ULK1 phosphorylation at Ser555. These observations indicate that ULK1 Ser555 phosphorylation indeed reflects ULK1 kinase activity in human skeletal muscle. They also elaborate our current understanding of the molecular link between ULK1 and LC3B, as they connect ULK1 to regulation of the class-III phosphatidylinositol 3-kinase complex. However, insulin did not decrease phosphorylation of ATG14 at Ser29, despite highly elevated phosphorylation of the inhibitory ULK1 site Ser757. This dissociation questions the link between ULK1 and ATG14. Alternatively, ATG14 is highly dephosphorylated at Ser29 in basal conditions. It can be speculated that inhibitory signaling through ULK1 Ser757 and ATG14 Ser29 represent a feedback mechanism that serves to inhibit autophagy only when flux (and ULK1 activity) is elevated.

Insulin inhibits autophagy through phosphorylation of ULK1 at Ser757, and this is associated with decreased protein degradation in human skeletal muscle (22). Moreover, the expression of autophagy-related proteins is repressed in patients with type 2 diabetes treated with high doses of insulin (15). Thus, the involvement of insulin in the regulation of autophagy in human skeletal muscle is well documented. We show that insulin’s effect on autophagy signaling is independent in hypoglycemic and euglycemic conditions, indicating that counterregulatory hormones have limited effects on autophagy signaling in human skeletal muscle. The data does not allow us to conclude that these hormones have no effects on autophagy, but they demonstrate that insulin inhibits autophagy signaling independent of counterregulatory hormone levels.

We have previously demonstrated that physical exercise increases autophagy signaling through ULK1 Ser555 in conditions with high and low insulin levels and that insulin does not increase ULK1 phosphorylation at Ser757 during exercise (16). Together with the data of the present study, these findings suggest a hierarchical order of regulation: physical exercise regulates autophagy signaling independent of insulin and insulin regulates autophagy signaling independent of counterregulatory hormones. The effects of exercise-associated hormones independent of exercise remain to be established. Importantly, insulin levels in the 2 studies were different at the time of biopsy sampling (40–60 pM in the exercise study and 100–200 pM in the hypoglycemia study). Therefore, we cannot exclude that counterregulatory hormones are involved in the regulation of autophagy signaling at lower insulin concentrations, for instance during exercise. In a previous study, one-legged exercise reduced LC3B-II levels and tended to increase ULK1 phosphorylation at Ser555 without any changes in the contralateral leg, which indicates that local factors indeed stimulated autophagy (5). Our data supports the hypothesis that local factors stimulate muscular autophagy during exercise rather than circulatory hormones.

ULK1 phosphorylation at Ser757 increased during insulin stimulation in both hypoglycemic and euglycemic conditions and correlated positively with mTOR Ser2448 phosphorylation. These observations recapitulate previous findings and demonstrate that insulin inhibits autophagy signaling through mTOR complex 1 (10, 22). They also reveal that insulin regulates ULK1 signaling independent of glucose levels. Glucose starvation is a widely used strategy to induce autophagy (14). Our data indicate that low insulin levels, rather than glucose, could be responsible for this response. This might tell us that autophagy has a minor role in regulation of energy homeostasis in human skeletal muscle. We further demonstrate that insulin decreases protein expression of ULK1, which indicates that insulin also inhibits autophagy by degradation of ULK1. Decreased ULK1 levels have recently been demonstrated to limit autophagy during starvation in cultured human cells because of impaired translation and increased degradation (1). Our data indicate that this mechanism of regulation remains intact in humans. Interestingly, protein levels of ULK1 returned to baseline levels 70 min after insulin administration along with the changes in ULK1 Ser757 phosphorylation. This could suggest that insulin regulates ULK1 through transcriptional mechanisms. Members of the FOXO family of transcription factors regulates the expression of autophagy-related genes (including ULK1, p62, and LC3B) in skeletal muscle and is known to be inhibited by insulin (19, 25). To investigate the effects of insulin on the transcriptional regulation of autophagy-related genes, we analyzed gene expression of p62 and LC3B, but none of these genes were differently expressed 30 and 75 min after a bolus of insulin. Thus, we do not find any evidence to support that insulin regulates autophagy-related gene expression. Instead, insulin may regulate ULK1 levels by balancing its degradation and synthesis.

Insulin stimulation decreased LC3B-II during hypoglycemic and euglycemic conditions, whereas LC3B-I remained unchanged. This indicates that insulin decreases the abundance of autophagosomes in the tissue, which could be due to both increased and decreased flux through the autophagy-lysosome system (13). The formation of new autophagosomes is reliant on the sustained production of LC3B-I for membrane expansion (4). A prerequisite for this is increased expression of the gene encoding LC3B. We analyzed gene expression of LC3B, but insulin did not change LC3B mRNA in either hypoglycemic or euglycemic conditions, which could indicate that flux through the system is decreased or unchanged. These data support that insulin inhibits autophagy in human skeletal muscle. However, these data should be interpreted cautiously as no method exists to assess autophagy flux in human tissues in vivo (11).

In conclusion, one hour of cycling exercise increases phosphorylation of ATG14 at Ser29 in a pattern that mirrors ULK1 phosphorylation at Ser555 (activating site), suggesting that ULK1 serves as an upstream kinase for ATG14 in human skeletal muscle. These effects were independent of high and low insulin levels during exercise. Insulin stimulates ULK1 phosphorylation at Ser757 (inhibitory site) in both hypoglycemic and euglycemic conditions, suggesting that counterregulatory hormones (such as epinephrine, norepinephrine, growth hormone, and glucagon) have limited effects on autophagy signaling in human skeletal muscle. Collectively, these data suggest that exercise-induced autophagy is stimulated by local factors in the skeletal muscle rather than circulatory hormones.

GRANTS

This study was supported by Aarhus University, the Novo Nordisk Foundation, the Keto Study Group/Danish Agency for Science and Technology and Innovation, the Danish Medical Research Council, and the A. P. Møller Foundation for the Advancement of Medical Science.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

A.B.M., T.S.V., M.H.V., N.M, and N.J. conceived and designed research; A.B.M., T.S.V., M.H.V., and S.B.P. performed experiments; A.B.M. and N.J. analyzed data; A.B.M., T.S.V., M.H.V., N.M, and N.J. interpreted results of experiments; A.B.M. prepared figures; A.B.M. drafted manuscript; A.B.M., T.S.V., M.H.V., S.B.P., N.M., and N.J. approved the final version of the manuscript.

ACKNOWLEDGMENTS

We thank Helle Zibrandtsen, Hanne Petersen, Elsebeth Hornemann, and Lenette Pedersen for skilled technical assistance during the studies.

REFERENCES

  • 1. Allavena G, Boyd C, Oo KS, Maellaro E, Zhivotovsky B, Kaminskyy VO. Suppressed translation and ULK1 degradation as potential mechanisms of autophagy limitation under prolonged starvation. Autophagy 12: 2085–2097, 2016. doi:10.1080/15548627.2016.1226733.
    Crossref | PubMed | ISI | Google Scholar
  • 2. Coffey VG, Hawley JA. The molecular bases of training adaptation. Sports Med 37: 737–763, 2007. doi:10.2165/00007256-200737090-00001.
    Crossref | PubMed | ISI | Google Scholar
  • 3. Egan DF, Chun MG, Vamos M, Zou H, Rong J, Miller CJ, Lou HJ, Raveendra-Panickar D, Yang CC, Sheffler DJ, Teriete P, Asara JM, Turk BE, Cosford ND, Shaw RJ. Small molecule inhibition of the autophagy kinase ULK1 and identification of ULK1 substrates. Mol Cell 59: 285–297, 2015. doi:10.1016/j.molcel.2015.05.031.
    Crossref | PubMed | ISI | Google Scholar
  • 4. Feng Y, He D, Yao Z, Klionsky DJ. The machinery of macroautophagy. Cell Res 24: 24–41, 2014. doi:10.1038/cr.2013.168.
    Crossref | PubMed | ISI | Google Scholar
  • 5. Fritzen AM, Madsen AB, Kleinert M, Treebak JT, Lundsgaard AM, Jensen TE, Richter EA, Wojtaszewski J, Kiens B, Frøsig C. Regulation of autophagy in human skeletal muscle: effects of exercise, exercise training and insulin stimulation. J Physiol 594: 745–761, 2016. doi:10.1113/JP271405.
    Crossref | PubMed | ISI | Google Scholar
  • 6. Gaitanos GC, Williams C, Boobis LH, Brooks S. Human muscle metabolism during intermittent maximal exercise. J Appl Physiol (1985) 75: 712–719, 1993. doi:10.1152/jappl.1993.75.2.712.
    Link | ISI | Google Scholar
  • 7. He C, Bassik MC, Moresi V, Sun K, Wei Y, Zou Z, An Z, Loh J, Fisher J, Sun Q, Korsmeyer S, Packer M, May HI, Hill JA, Virgin HW, Gilpin C, Xiao G, Bassel-Duby R, Scherer PE, Levine B. Exercise-induced BCL2-regulated autophagy is required for muscle glucose homeostasis. Nature 481: 511–515, 2012. [Erratum in Nature 503: 146, 2013]. doi:10.1038/nature10758.
    Crossref | PubMed | ISI | Google Scholar
  • 8. He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet 43: 67–93, 2009. doi:10.1146/annurev-genet-102808-114910.
    Crossref | PubMed | ISI | Google Scholar
  • 9. Jessen N, Sundelin EI, Møller AB. AMP kinase in exercise adaptation of skeletal muscle. Drug Discov Today 19: 999–1002, 2014. doi:10.1016/j.drudis.2014.03.009.
    Crossref | PubMed | ISI | Google Scholar
  • 10. Kim J, Kundu M, Viollet B, Guan KL. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol 13: 132–141, 2011. doi:10.1038/ncb2152.
    Crossref | PubMed | ISI | Google Scholar
  • 11. Klionsky DJ, et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 12: 1–222, 2016. [Erratum in Autophagy 12: 443, 2016]. doi:10.1080/15548627.2015.1100356.
    Crossref | PubMed | ISI | Google Scholar
  • 12. Lira VA, Okutsu M, Zhang M, Greene NP, Laker RC, Breen DS, Hoehn KL, Yan Z. Autophagy is required for exercise training-induced skeletal muscle adaptation and improvement of physical performance. FASEB J 27: 4184–4193, 2013. doi:10.1096/fj.13-228486.
    Crossref | PubMed | ISI | Google Scholar
  • 13. Mizushima N, Yoshimori T. How to interpret LC3 immunoblotting. Autophagy 3: 542–545, 2007. doi:10.4161/auto.4600.
    Crossref | PubMed | ISI | Google Scholar
  • 14. Mizushima N, Yoshimori T, Levine B. Methods in mammalian autophagy research. Cell 140: 313–326, 2010. doi:10.1016/j.cell.2010.01.028.
    Crossref | PubMed | ISI | Google Scholar
  • 15. Møller AB, Kampmann U, Hedegaard J, Thorsen K, Nordentoft I, Vendelbo MH, Møller N, Jessen N. Altered gene expression and repressed markers of autophagy in skeletal muscle of insulin resistant patients with type 2 diabetes. Sci Rep 7: 43775, 2017. doi:10.1038/srep43775.
    Crossref | PubMed | ISI | Google Scholar
  • 16. Møller AB, Vendelbo MH, Christensen B, Clasen BF, Bak AM, Jørgensen JO, Møller N, Jessen N. Physical exercise increases autophagic signaling through ULK1 in human skeletal muscle. J Appl Physiol (1985) 118: 971–979, 2015. doi:10.1152/japplphysiol.01116.2014.
    Link | ISI | Google Scholar
  • 17. Møller AB, Vendelbo MH, Rahbek SK, Clasen BF, Schjerling P, Vissing K, Jessen N. Resistance exercise, but not endurance exercise, induces IKKβ phosphorylation in human skeletal muscle of training-accustomed individuals. Pflugers Arch 465: 1785–1795, 2013. doi:10.1007/s00424-013-1318-9.
    Crossref | PubMed | ISI | Google Scholar
  • 18. Nair U, Klionsky DJ. Activation of autophagy is required for muscle homeostasis during physical exercise. Autophagy 7: 1405–1406, 2011. doi:10.4161/auto.7.12.18315.
    Crossref | PubMed | ISI | Google Scholar
  • 19. O’Neill BT, Lee KY, Klaus K, Softic S, Krumpoch MT, Fentz J, Stanford KI, Robinson MM, Cai W, Kleinridders A, Pereira RO, Hirshman MF, Abel ED, Accili D, Goodyear LJ, Nair KS, Kahn CR. Insulin and IGF-1 receptors regulate FoxO-mediated signaling in muscle proteostasis. J Clin Invest 126: 3433–3446, 2016. doi:10.1172/JCI86522.
    Crossref | PubMed | ISI | Google Scholar
  • 20. Russell RC, Tian Y, Yuan H, Park HW, Chang YY, Kim J, Kim H, Neufeld TP, Dillin A, Guan KL. ULK1 induces autophagy by phosphorylating Beclin-1 and activating VPS34 lipid kinase. Nat Cell Biol 15: 741–750, 2013. doi:10.1038/ncb2757.
    Crossref | PubMed | ISI | Google Scholar
  • 21. Vendelbo MH, Christensen B, Grønbæk SB, Høgild M, Madsen M, Pedersen SB, Jørgensen JO, Jessen N, Møller N. GH signaling in human adipose and muscle tissue during ‘feast and famine’: amplification of exercise stimulation following fasting compared to glucose administration. Eur J Endocrinol 173: 283–290, 2015. doi:10.1530/EJE-14-1157.
    Crossref | PubMed | ISI | Google Scholar
  • 22. Vendelbo MH, Moller AB, Christensen B, Nellemann B, Clasen BF, Nair KS, Jorgensen JO, Jessen N and Moller N. Fasting increases human skeletal muscle net phenylalanine release and this is associated with decreased mTOR signaling. PLoS One 9: e102031, 2014. doi:10.1371/journal.pone.0102031.
    Crossref | PubMed | ISI | Google Scholar
  • 23. Voss TS, Vendelbo MH, Kampmann U, Hingst JR, Wojtaszewski JFP, Svart MV, Møller N, Jessen N. Acute hypoglycemia in healthy humans impairs insulin-stimulated glucose uptake and glycogen synthase in skeletal muscle: a randomized clinical study. Diabetes 66: 2483–2494, 2017. doi:10.2337/db16-1559.
    Crossref | PubMed | ISI | Google Scholar
  • 24. Yang Z, Klionsky DJ. Mammalian autophagy: core molecular machinery and signaling regulation. Curr Opin Cell Biol 22: 124–131, 2010. doi:10.1016/j.ceb.2009.11.014.
    Crossref | PubMed | ISI | Google Scholar
  • 25. Zhao J, Brault JJ, Schild A, Cao P, Sandri M, Schiaffino S, Lecker SH, Goldberg AL. FoxO3 coordinately activates protein degradation by the autophagic/lysosomal and proteasomal pathways in atrophying muscle cells. Cell Metab 6: 472–483, 2007. doi:10.1016/j.cmet.2007.11.004.
    Crossref | PubMed | ISI | Google Scholar

AUTHOR NOTES

  • Address for reprint requests and other correspondence: N. Jessen, Dept. of Biomedicine, Aarhus Univ., Aarhus DK-8200 Denmark (e-mail: ).