ARTICLES

Regulation of sodium-dicarboxylate cotransporter-3 from winter flounder kidney by protein kinase C

Abstract

The sodium dicarboxylate cotransporter located at the basolateral side supplies renal proximal tubule cells with Krebs cycle intermediates and maintains the driving force for the exchange of organic anions like PAH against α-ketoglutarate through the organic anion transporter-1. Recently, we cloned sodium dicarboxylate cotransporter-3 from winter flounder kidney (fNaDC-3). To understand the regulation of fNaDC-3, we preincubated fNaDC-3-expressing oocytes with PMA, a PKC activator. PMA dose and time dependently inhibited fNaDC-3-mediated succinate uptake. Simultaneous preincubation of fNaDC-3-expressing oocytes with 50 nM PMA and either staurosporine or RO 31-8220 for 30 min attenuated PKC-mediated inhibition of succinate uptake. Site-directed mutagenesis of the five putative PKC sites (S7, T167, S174, T188, and S396) resulted in no change in PKC-mediated inhibition of the transporter. In electrophysiological studies performed at -60 mV, the K0.5 for succinate was not significantly affected (56 ± 13 vs. 42 ± 19 μM), but ΔImax was reduced from -139 ± 49 to -20 ± 8 nA by PMA (50 nM, 30 min). Immunofluorescence analysis of fNaDC-3-expressing oocytes revealed that PMA leads to an endocytosis of fNaDC-3 protein. In conclusion, fNaDC-3 expressed in oocytes is downregulated by PMA through endocytosis. PKC consensus sites appear not to be important for this process.

krebs cycle intermediates, such as citrate, α-ketoglutarate, and succinate, play a central role in energy metabolism. Because these compounds are highly hydrophilic, carriers are needed for their translocation across plasma and mitochondrial membranes. Renal proximal tubule cells use di- and tricarboxylates as metabolic fuels and extract them from primary urine and blood.

For this purpose, the cells are endowed with Na+-dicarboxylate cotransporters (NaDC) in their luminal and contraluminal cell membrane. These transporters have been cloned and named NaDC-1 and -3 (for a review, see Ref. 23). Cotransporters of the NaDC-1 subfamily appear to be located at the luminal membrane of proximal tubule cells, as it was shown for rabbit renal brush-border membrane vesicles in Western blots (25) and for rat NaDC-1 by immunohistochemistry (32). NaDC-1 has a relatively low affinity for succinate (Km greater than 0.18 mM). An exception is the rat renal Na+-dicarboxylate cotransporter (rNaDC)-1 (32) or SDCT1 (7), which exhibits a high affinity for succinate (Km 29 and 24 μM).

The Na+-dicarboxylate cotransporters of the NaDC-3 subfamily have been cloned from rat kidney [SDCT2 (6), rNaDC-3 (17)], flounder kidney [fNaDC-3 (34)], human placenta [hNaDC-3 (35)], and mouse brain [mNaDC-3 (24)]. Upon heterologous expression, these transporters exhibited a relatively high affinity for succinate (Km less than 0.1 mM). They also differ from the NaDC-1 transporters by their pH sensitivity (22, 32, 34) and their interaction with 2,3-substituted succinate derivatives such as the clinically used heavy metal chelator 2,3-dimercaptosuccinate (2). On the basis of these functional characteristics, it has been assumed that NaDC-3 is located at the basolateral membrane (BLM) of proximal tubule cells. With the use of antibodies specific for NaDC-3, we localized this transporter at the BLM of flounder renal proximal tubule cells of segment PII (13). Preliminary data are available on the basolateral localization of NaDC-3 in rat and human proximal tubules (5).

NaDC-3 has also been found in liver (perivenous hepatocytes; 24), the placenta (35), and in glial cells (15) of rats. In the liver, NaDC-3 provides hepatocytes with α-ketoglutarate for the synthesis of glutamine. Placental NaDC-3 is most probably involved in the delivery of Krebs cycle intermediates to the fetus. The physiological role of NaDC-3 in the brain is the uptake of neurotransmitter precursors into neurons. The intracellular pools of neurotransmitters in neurons, particularly of glutamate, are maintained by the metabolism of dicarboxylates such as α-ketoglutarate (33). Furthermore, these transporters are an important component in the metabolism of N-acetylaspartate in the process of myelinization (15).

The Drosophila melanogaster gene INDY (I Am Not Dead Yet) shows a significant homology to NaDC-3. Functional expression of INDY revealed transport of citrate and substrate specificity different from those of NaDC-1 and -3 (18, 28). A functional defect by mutation of the INDY gene led to a life span extension of Drosophila (28). Apparently, the mutation slowed down the uptake of dicarboxylates, resulting in a moderate caloric restriction and consequent increase in life span. These findings shed new light on the role of di- and tricarboxylate transporters in energy metabolism.

Given the distribution and functional roles of NaDC-3, it is important to know its regulation by protein kinases. The flounder renal NaDC-3 contains five consensus sites for PKC. Therefore, we tested the influence of an activator of PKC, PMA, on the activity of fNaDC-3 NaDC-3 expressed in Xenopuslaevis oocytes. Here, we provide evidence for a downregulation of fNaDC-3 by PKC, which does not involve any of the consensus sites and which is mediated by endocytosis of NaDC-3 protein.

MATERIALS AND METHODS

Chemicals. Unless specified otherwise, all chemicals were of analytic grade and purchased from Sigma (Deisenhofen, Germany), Applichem (Darmstadt, Germany), or Merck (Darmstadt, Germany).

In vitro cRNA synthesis. The pSPORT vector containing fNaDC-3 cDNA (wild-type or mutants) was used for cRNA synthesis. After NotI linearization of the plasmid, in vitro transcription was carried out using the T7 RNA polymerase (mMessage mMachine kit, Ambion, Austin, TX). The cRNA was purified by phenol-chloroform extraction, resuspended in water, and adjusted to a final concentration of 1 μg/μl.

Site-directed mutagenesis. A prediction of the putative phosphorylation sites was made by using http://www.cbs.dtu.dk/databases/PhosphoBase/predict/predict.html. This program indicated five putative PKC consensus sites. The role of these five putative PKC consensus sites in the downregulation process of fNaDC-3-dependent dicarboxylate transport was investigated by site-directed mutagenesis. The amino acids S7, T167, S174, T188, and S396 located within the putative intracellular loops or close to transmembrane domains were mutated using the QuikChange site-directed mutagenesis kit (Stratagene, Cambridge, UK). Table 1 shows the primer pairs used for mutagenesis (MWG Biotech, Munich, Germany). Underlined and bold nucleotides indicate the mutations.

Table 1. Survey of primers used in the study


Mutants



Primer Sequence
fNaDC3-S7A Sense GATGAAAATCTCTGTGGTTGCCAAGAAGCTGTGGTG
fNaDC3-S7A Antisense CACCACAGCTTCTTGGCAACCACAGAGATTTTCATC
fNaDC3-T167A Sense GAAGACCTGGAGGCGCTGAAGAAGAAC
fNaDC3-T167A Antisense GTTCTTCTTCAGCGCCTCCAGGTCTTC
fNaDC3-S174A Sense GAAGAACTGCAAGGCCCCAAAGAATTCAGA
fNaDC3-S174A Antisense TCTGAATTCTTTGGGGCCTTGCAGTTCTTC
fNaDC3-T188A Sense CATAAATGGTCAGTGCGCTTTAAAGATGCATTCACT
fNaDC3-T188A Antisense AGTGAATGCATCTTTAAAGCGCACTGACCATTTATG
fNaDC3-S396A Sense CATATTGTTCTTCTTCCCGGCGCAGAAACCTTCTCT
fNaDC3-S396A
Antisense
AGAGAAGGTTTCTGCGCCGGGAAGAAGAACAATATG

fNaDC3, flounder sodium-dicarboxylate cotransporter 3. Underlined and bold letters indicate mutations.

Mutagenesis and polymerase fidelity were verified by sequencing. Both strands of the fNaDC-3 mutants were sequenced by the dye terminator cycle-sequencing method on an automatic sequencer (ABI 377, Applied Biosystems, Weiterstadt, Germany) using fNaDC-3-specific primers.

Expression of fNaDC-3. Stage V and VI oocytes from Xenopus laevis ovaries (Nasco, Fort Atkinson, WI) were prepared by an overnight treatment with collagenase (type CLSII, Biochrom, Berlin, Germany). Subsequently, after being washed with Ca2+-free modified control solution (90 mM NaCl, 3 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 5 mM HEPES/Tris, pH 7.6), the oocytes were incubated at 18°C in modified Barth's solution [88 mM NaCl, 1 mM KCl, 0.3 mM Ca(NO3)2, 0.41 mM CaCl2, 0.82 mM MgSO4, 5 mM HEPES/NaOH, pH 7.6]. The oocytes were injected with 23 nl of 1 μg/μl cRNA or with an equivalent volume of H2O for control. Injected oocytes were incubated for 3 days in Barth's buffer supplemented with gentamycin (12 mg/ml) and 2.5 mM sodium pyruvate at 18°C. The medium was changed every day, and damaged oocytes were removed from the wells.

Electrophysiological studies. These studies were carried out 3 days after cRNA injection by the two-microelectrode voltage clamp using a commercial amplifier (OC 725, Warner, Hambden, CT). The microelectrodes were filled with 3 M KCl and had resistances ∼1 MΩ. The resting membrane potential of the oocytes was -20 to -50 mV. Holding currents under a clamp potential of -60 mV were between -20 and -80 nA. Substrate-induced currents were elicited by changing superfusion of the oocyte from control solution to a solution containing in addition the substrate. Afterward, the substrate was washed away with control solution and experiments were continued only when the current had returned to baseline. Data were expressed as means ± SE. The Michaelis-Menten parameters (Km), the substrate concentration at half-maximal current, and ΔImax, the maximum substrate-induced current observed at saturating substrate concentrations, were obtained by Eadie-Hofstee analysis.

Succinate uptake experiments. Transport experiments were carried out 3 days after injection. The oocytes were washed three times with control solution. For the uptake experiment, we incubated the oocytes for 30 min in control solution containing 18.1 μM [2,3-14C]succinate (New England Nuclear Life Science, Cologne, Germany). Succinate uptake was terminated after 30 min by sucking off of the transport medium and immediate 3 × 3 ml washings with ice-cold control solution. Each oocyte was then dissolved in 0.1 ml of 1 N NaOH. After neutralization with 0.1 ml 1 N HCl, the 14C content was measured by liquid scintillation counting (Tri-CARB 2100TR, Packard, Dreieich, Germany). To determine the effects of PKC activators and inhibitors on the fNaDC-3-mediated succinate uptake, oocytes were preincubated with PMA, staurosporine, and RO 31-8220 usually for 30 min and then washed with control solution. Subsequent uptake experiments were carried out as described above.

Immunohistochemistry of fNaDC-3-expressing oocytes. Surface staining of fNaDC-3 protein with specific antibodies, generated by fNaDC-3-specific antigen (CKSPKDSDSDII) in rabbits (Eurogentec, Seraing, Belgium), was carried out as described previously (38). Oocytes were devitellinized manually and incubated for 5 to 10 min in 200 mM potassium aspartate, followed by fixation in Dent's solution (80% methanol, 20% DMSO) at -20°C overnight. After the fixation solution was removed, oocytes were incubated with rabbit anti-fNaDC-3 antibodies in a dilution of 1:50 and 10% goat serum at 4°C overnight. Twelve hours later, the primary antibody was washed out with PBS and the oocytes were incubated with the secondary antibody Alexa fluor 488 goat anti-rabbit at a dilution of 1:200 (Molecular Probes, Eugene, OR) for 1 h. To remove nonspecific labeling of the secondary antibody, the oocytes were washed several times with PBS and fixed for 30 min with 3.7% paraformaldehyde. The oocytes were embedded in acrylamide (Technovit 7100, Heraeus Kulzer, South Bend, IN) according to the manufacturer's description. Five-micrometer sections from the embedded oocytes were analyzed with a fluorescence microscope (Zeiss Axiovert S100TV, Jena, Germany) supported by Digital Imaging (Metamorph software universal imaging, Jena, Germany).

Quantitative determination of the protein concentration by spectrophotometry. For quantification of the protein release by cortical granule exocytosis triggered by PMA, we used a modified method described originally by Bement and Capco (1). Twenty oocytes were transferred carefully in a 1-ml quartz cuvette and incubated in 600 μl control solution supplemented with 50 nM PMA or 50 nM 4-α-phorbol-12,13-didecanoate (4αPDD), or 50 nM PMA + 10 μM staurosporine, or 50 nM PMA + 20 μM cytochalasin D, or 50 nM PMA + 20 μM colchicine. Every 5 min we measured the absorbance at 280 nm to determine the concentration of protein released into the buffer surrounding the oocyte. Protein concentration was calculated using BSA as a standard.

RESULTS

Effect of a phorbol ester on fNaDC-3-mediated succinate uptake. Acute regulation of fNaDC-3 was studied by measuring succinate uptake into fNaDC-3-expressing X. laevis oocytes. Initially, we examined the time and concentration dependence of the PKC activator PMA. The observed inhibition of succinate transport by PMA was time dependent. As shown in Fig. 1 (filled bars), 50 nM PMA caused a significant inhibition of succinate uptake by 50.5 ± 14.9% at 5 min (P < 0.01), 79.0 ± 4.0% at 30 min (P < 0.01), and by 90.5 ± 1.7% at 60 min (P < 0.001). fNaDC-3 cRNA-injected control oocytes, which were preincubated with DMSO, the solvent for PMA, showed an unaltered succinate uptake (Fig. 1, open bars), excluding an effect of DMSO on transport. For the following experiments, a preincubation time of 30 min was chosen, because oocytes tended to deteriorate at 60 min of preincubation time. As shown in Fig. 2, 30 min of preincubation with PMA resulted in a concentration-dependent inhibition of succinate transport with a calculated IC50 for PMA of 3.5 ± 0.8 nM in three independent experiments using 8-10 oocytes for every experimental condition.

Fig. 1.

Fig. 1.Time dependence of PMA inhibition. Oocytes expressing sodium-dicarboxylate cotransporter-3 from winter flounder kidney (fNaDC-3) were preincubated without (open bars) or with 50 nM PMA for 5, 30, and 60 min (filled bars) followed by an uptake of 18.1 μM [14C]succinate for 30 min at RT. The controls were incubated with the same amount of DMSO for the same time to exclude an effect of the solvent of PMA. The points are means (±SE) of uptakes determined in 3 separate experiments with 8-10 oocytes for each condition.


Fig. 2.

Fig. 2.Kinetics of PMA inhibition. fNaDC-3-expressing oocytes were preincubated with different PMA concentrations for 30 min followed by an uptake of 18.1 μM [14C]succinate for 30 min at RT. Each point is calculated as percentage of [14C]succinate accumulation under control conditions (100%) measured without inhibitor. The points are means (±SE) of uptakes determined in 3 separate experiments with 8-10 oocytes for each condition. IC50 calculation was based on a nonlinear regression algorithm.


Effect of PKC inhibitors on fNaDC-3 activity. To test whether the inhibitory effect of PMA on succinate uptake occurred via increased PKC activity, we determined the influence of staurosporine, a PKC inhibitor, and of RO 31-8220, a highly potent PKC inhibitor (36), on fNaDC-3-mediated succinate uptake. Oocytes expressing fNaDC-3 were preincubated for 30 min with 50 nM PMA and either 10 μM staurosporine or 0.1 μM RO 31-8220, respectively. As shown in Fig. 3, application of staurosporine or of RO 31-8220 alone did not change succinate uptake (compare 3rd and 5th bars with control open bar). Preincubation of 10 μM staurosporine together with 50 nM PMA partially, but significantly, restored succinate uptake, which was inhibited by 83 ± 3.0% with PMA (2nd bar) and by 50.8 ± 8.9% with PMA plus staurosporine (4th bar). Simultaneous incubation of RO 31-8220 and PMA also showed a partial, but statistically, significant restoration (36.3 ± 10.1% inhibition) of fNaDC-3-mediated succinate uptake (compare 6th with 2nd bar). These results suggest an involvement of PKC in the downregulation of fNaDC-3 activity in X. laevis oocytes.

Fig. 3.

Fig. 3.Influence of a PKC activator and PKC inhibitors on fNaDC-3 transport activity. The effect of 50 nM PMA, 0.1 μM RO 31-8220, and 10 μM staurosporine (Stau) on the uptake of 18.1 μM [14C]succinate into fNaDC-3-expressing oocytes was tested. Data (filled bars) are calculated as percentage of [14C]succinate accumulation under control conditions (100%) measured without inhibitor (open bar). The results are means (±SE) of uptakes determined in 3 separate experiments with a total of 8-10 oocytes. ***P < 0.001 (Student's t-test).


Other PKC-induced effects in oocytes. Bement and Capco (1) reported that PMA through activation of PKC induces a cortical granule exocytosis in oocytes and a release of granule proteins into supernatant. We quantified the protein release by measuring the absorbance at 280 nm. Twenty oocytes were incubated with 600 μl medium supplemented with DMSO, 50 nM the inactive phorbol ester 4αPDD, 50 nM PMA, 50 nM PMA + 10 μM staurosporine, 50 nM PMA + 20 μM cytochalasin D, or 50 nM PMA + 20 μM cholchicine, respectively. The spectrophotometrical determination of protein concentration in the supernatant after 30-min incubation yielded the following results: DMSO 1.34 ± 0.4 μg/oocyte; 4αPDD 1.43 ± 0.69 μg/oocyte; PMA 12.79 ± 1.0 μg/oocyte; PMA + staurosporine 2.50 ± 0.2 μg/oocyte; PMA + cytochalasin D 2.31 ± 0.4 μg/oocyte; and PMA + cholchicine 2.25 ± 0.5 μg/oocyte (n = 4, oocytes from 2-3 donors). Thus PMA, but not 4αPDD, induced PKC-mediated protein release that was inhibited by up to 90% by staurosporine and up to 92% by cytochalasin D and cholchicine.

Mutational analysis of putative PKC phosphorylation sites. The protein sequence of fNaDC-3 contains five canonical PKC consensus sites. These phosphorylation sites at Ser 7, Thr 167, Ser 174, Thr 188, and Ser 396 are located intracellularly as based on the putative secondary structure model of fNaDC-3 with 11 transmembrane domains (Fig. 4). To check which of these PKC phosphorylation sites is involved in downregulation of fNaDC-3, site-directed mutagenesis of each PKC site (S7A, T167A, S174A, T188A, and S396A) was performed. In addition, we mutated all PKC sites simultaneously (“pentamutant”). As shown in Fig. 5, all mutants were able to transport succinate (open bars), suggesting that the mutated serines and threonines are not important for the function of fNaDC-3. To test whether the PKC-mediated downregulation was abolished in the mutants, we tested the influence of 50 nM PMA (30 min). All five individual mutants and the pentamutant showed inhibition of succinate transport by PMA (Fig. 5, filled bars). There was no statistically significant difference in PMA-induced inhibition between wild-type and the mutants of fNaDC-3 tested in the same experiment (P > 0.05). These data suggest that the inhibitory effect of PMA on fNaDC-3 transport activity does not depend on a phosphorylation of fNaDC-3 at the investigated PKC consensus sites.

Fig. 4.

Fig. 4.Model of the putative secondary structure of fNaDC-3. The prediction of the secondary structure of fNaDC-3 was performed with TopPred 2 ( http://bioweb.pasteur.fr/seqanal/interfaces/toppred.html). Putative PKC phosphorylation sites of fNaDC-3 are highlighted (•). Search was performed by program ( http://www.cbs.dtu.dk/databases/PhosphoBase/predict/predict.html). Each of these sites was mutated by site-directed mutagenesis and analyzed for PKC influence.


Fig. 5.

Fig. 5.Transport activity of fNaDC-3 mutants. Analysis of the PMA sensitivity using 50 nM PMA and 30-min preincubation was performed in fNaDC-3 mutants measured by the uptake of 18.1 μM [14C]succinate into Xenopus laevis oocytes. Transport activities are shown as a percentage of transport activity of fNaDC-3 wild-type (WT; 100%), without (open bars) and with 50 nM PMA treatment (filled bars). “Pentamutant” describes the removal of all 5 PKC sites from the WT. Data shown are means (±SE) of 3 independent experiments with 8-10 oocytes for each condition.


Regulation of fNaDC-3 activity by PKC studied with the two-electrode voltage-clamp technique. A 30-min preincubation of fNaDC-3-expressing oocytes with PMA resulted in a dose-dependent decrease of succinate-associated currents. Maximal inhibition was reached at PMA concentrations higher than 50 nM. At 50 nM PMA, succinate-induced currents were 30 ± 12% of those measured in the absence of PMA. In addition, succinate-induced currents were unaffected by 50 nM 4αPDD (94 ± 7% compared with untreated control, 4 oocytes from 3 donors). The decrease in succinate-induced current by preincubation of the oocytes by PMA (50 nM) was partially antagonized by staurosporine (10 μM). At -60 mV, measured in six to seven oocytes under each experimental condition, the normalized succinate-elicited currents, Isucc + PMA/Isucc, Isucc + staurosporine/Isucc, and Isucc + staurosporine + PMA/Isucc were 0.10 ± 0.02, 0.72 ± 0.18, and 0.36 ± 0.22, respectively.

Next, we determined on the same oocyte whether PMA treatment affects Km or ΔImax. At -60 mV in the absence and presence of PMA (50 nM), currents induced by increasing succinate concentrations tended to saturate at concentrations >0.5 mM (Fig. 6). The succinate-associated currents in the presence of PMA were smaller than those measured in its absence. As obtained in four oocytes from four donors, Km in the absence and presence of PMA was 56 ± 13 and 42 ± 19 μM, respectively, whereas ΔImax was -139 ± 49 and -20 ± 8 nA. These data are compatible with a decrease in the number of the transporters in the membrane.

Fig. 6.

Fig. 6.Effect of PMA (50 nM) on currents associated with increasing succinate concentrations as obtained at -60-mV clamp potential (Vc). Oocytes expressing fNaDC-3 were superfused with increasing succinate concentrations (0.01 to 1 mM) in the absence or after a 30-min preincubation with 50 nM PMA. Each point represents means ± SE of 4 oocytes from 4 donors.


Immunohistochemistry of fNaDC-3-expressing oocytes. To address the question of whether the observed downregulation of fNaDC-3 activity by PKC is the result of an endocytosis of the transport protein, we investigated the localization of fNaDC-3 in oocytes by immunohistochemistry. We used polyclonal rabbit antibodies raised against a specific fNaDC-3 peptide to detect the expression of the transporter on the oocyte surface. Compared with water-injected oocytes (Fig. 7A), fNaDC-3-expressing oocytes showed clear staining of the surface (B). After treatment of fNaDC-3-expressing oocytes with 50 nM PMA for 30 min, fNaDC-3-specific staining revealed a broad band below the plasma membrane, suggesting a PMA-induced endocytosis (Fig. 7C).

Fig. 7.

Fig. 7.Immunohistochemistry of fNaDC-3-expressing oocytes. Devitellinized X. laevis oocytes expressing fNaDC-3 were incubated with rabbit anti-fNaDC-3 antibodies in a dilution of 1:50 followed by the secondary antibody Alexa fluor 488 goat anti-rabbit in a dilution of 1:200. Sections of 5 μm were analyzed with a fluorescence microscope. A: H2O-injected oocytes. B: fNaDC-3-expressing oocytes without PMA treatment. C: fNaDC-3-expressing oocytes incubated with 50 nM PMA for 30 min at RT.


DISCUSSION

NaDC-1 and -3 supply renal proximal tubule cells with Krebs cycle intermediates. In addition, these transporters build up an α-ketoglutarate gradient, serving as a driving force for the basolateral “classic” organic anion transporter 1 (3).

fNaDC-3 possesses five putative PKC and two PKA phosphorylation sites. To assess the role of PKC in short-term regulation of NaDC-3, we first studied the effect of PMA, a known PKC activator, on transport activity. PMA inhibited in a time- and concentration-dependent manner fNaDC-3-mediated [14C]succinate uptake and succinate-induced inward currents. In contrast, the basolateral [14C]glutarate uptake into nonperfused isolated rabbit S2 segment of proximal tubules was not affected by treatment with 100 nM PMA (29). The reason for this discrepancy is not known with certainty. However, regulation may be species dependent. Such a species-specific regulation has been shown for human SGLT1, which was stimulated by the PKC activator sn-1,2-dioctanoylglycerol (DOG), whereas rat SGLT1 as well as rabbit SGLT1 were inhibited by DOG when expressed in oocytes (14).

Application of 50 nM PMA did not lead to a complete inhibition of the fNaDC-3 transport function, whereas a complete inhibition was observed with rabbit NaDC-1 (26). An incomplete inhibition, as observed in our experiments by PMA, was also found with the human dopamine transporter (hDAT), independent of whether the transporter was expressed in Madin-Darby canine kidney (MDCK) cells (9) or X. laevis oocytes (40), and with γ-aminobutyric acid transporter 1 (GAT1) and glycine transporter 1b (GLYT1b), both expressed in HEK 293 cells (30, 31). The calculated IC50 of PMA for inhibition of fNaDC-3 (4 nM PMA) was less than the IC50 for inhibition of rbNaDC-1 (12 nM PMA; Ref. 26) and hDAT in oocytes (23 nM PMA; Ref. 40). IC50 values for the inhibition of the other above-mentioned transporters have not been reported. Simultaneous incubation of fNaDC-3-expressing oocytes with 50 nM PMA and either 10 μM staurosporine or 0.1 μM RO 31-8220 reduced the inhibitory effect of PMA but did not restore transport activity completely. Similar findings were reported for bisindolylmaleimide, another PKC inhibitor, which did not completely restore the activity of hDAT expressed in oocytes (40) and in PC-12 (20) cells. However, staurosporine and 1-(5-isoquinolinylsulphonyl)-2-methylpiperazine completely reversed the inhibition by PMA of GLYT1b and GAT1 in HEK 293 cells (30, 31). The activity of the rbNaDC-1 was partially restored by 10 μM and fully by 20 μM staurosporine (26). We did not use staurosporine concentrations greater than 10 μM, because of nonspecific effects on succinate transport.

To examine whether the PKC was indeed stimulated, we measured the protein release caused by cortical granule exocytosis, which is a PKC-mediated process in oocytes (1). We found that the activation of PKC by 50 nM PMA led to a 10-fold increase of protein release compared with the absence of PMA or to the incubation of oocytes with 50 nM 4αPDD, an inactive phorbol ester. These findings demonstrate clearly an activation of PKC in the oocytes and the initiation of physiological functions such as the release of proteins by cortical granule exocytosis (1). With 10 μM staurosporine, the protein release dropped to 10.1 ± 1.58% compared with the protein release achieved by PMA (100 ± 7.9%) treatment alone. In contrast to the 90% inhibition of protein release, fNaDC-3-mediated succinate uptake was inhibited by 83 ± 3.0% by PMA and simultaneous incubation of PMA and staurosporine restored the activity of the transporter only to 50.8 ± 8.9%; i.e., the PMA effect was attenuated by 39%. This discrepancy could be due to PMA activation of other proteins, which regulate the transport process mediated by fNaDC-3. Some proteins have been reported as nonkinase phorbol ester receptors (16). However, nothing is known about the existence, function, and regulatory role of these proteins in oocytes.

An inhibition by PMA was shown in oocytes for several transporters like hDAT (10, 40), GAT1 (8, 27), GLAST1 (8), and NaPi-2 (12), suggesting an oocyte-specific regulation. However, as mentioned above, rabbit and rat SGLT1 were inhibited by PMA in oocytes, whereas human SGLT1 was stimulated in the same expression system (14). Moreover, NaPi-2 expressed in X. laevis oocytes was inhibited by DOG, whereas NaSi-1 expressed in the same oocyte was not (11). Therefore, inhibition of transporter activity is not a generalized reaction of oocytes to PKC activators. The effect of phorbol esters is rather a carrier-specific regulation.

The downregulation could be due to a direct PKC-mediated phosphorylation of the transporter protein, as was shown for PKC-dependent phosphorylation of serine 113 of rat brain glutamate transporter (rGLT-1) (4). The mutation of serine 113 of rGLT-1 to asparagine did not change the level of expressed transport but abolished the stimulation of the transporter by the phorbol ester 12-O-tetradecanylphorbol-13-acetate. Moreover, the activation of PKC by DOG showed an increased phosphorylation of rOCT1 (rat organic cation transporters 1; Ref. 19). The putative 11 transmembrane model of fNaDC-3, a prediction that is closely related to topological studies documented for rbNaDC-1 (39), suggested the intracellular localization of all five potential PKC phosphorylation sites. To verify the role of these sites, we replaced the amino acids serine and threonine by alanine. The transport activity of fNaDC-3 remained unimpaired by removal of a single or of all putative PKC sites in the wild-type, indicating that these serines and threonines are not important for membrane targeting and function of fNaDC-3. The mutants of fNaDC-3 did not reveal differences in [14C]succinate uptake in the presence and absence of PMA compared with the wild-type fNaDC-3-expressing oocytes. Consequently, downregulation of transport activity by PKC activators is independent of canonical PKC phosphorylation sites. Comparable results were reported for rbNaDC-1 (26), GLAST-1, NaPi-2 (8, 11), and for hOAT1, a further transporter located at the BLM of proximal tubule cells (37). In the case of GLAST-1, a phosphorylation at a noncanonical PKC site was responsible for the inhibition of the transporter activity after PMA treatment (8). Therefore, the inhibition of fNaDC-3 could be mediated by phosphorylation at an unknown site or, alternatively, by phosphorylation of an ancillary regulatory protein.

The inhibition of NaPi-2, hDAT (11, 40), and the stimulation of GAT-1, respectively, were due to a change in Vmax without significant variations in the affinity (Km). In expression systems other than oocytes, also only Vmax was altered, as it was demonstrated for GLYT1b and GAT-1 in HEK 293 (30, 31) and for DAT in MDCK cells (9). Studies on rOCT1 expressed in HEK 293 cells, however, demonstrated an increase in the affinity (Km) after activation of PKC by DOG (19). To verify whether the observed inhibition of succinate-induced currents is due to a change in substrate affinity (Km) or in the maximal substrate-induced current (ΔImax), we examined fNaDC-3-expressing oocytes with the two-electrode voltage-clamp technique. Km and ΔImax were determined for succinate in the absence or presence of PMA consecutively on the same oocytes. In these experiments, we found an 85% decrease in the maximal substrate-induced current (ΔImax) without a significant change in substrate affinity (Km).

These findings suggest that an endocytotic process could be involved in the regulation of fNaDC-3, leading to a decrease in the amount of transport protein in the plasma membrane and consequently to a reduction of the maximal transport rate (Vmax or ΔImax). Therefore, we performed immunofluorescence studies on fNaDC-3-expressing oocytes, applying specific antibodies for fNaDC-3. fNaDC-3-expressing oocytes were incubated with or without PMA. Oocytes not pretreated with PMA showed a clearcut immunoreactivity at the level of the plasma membrane with occasional punctate fluorescence in the cytosol. This finding suggested that most of the fNaDC-3 protein is located in the plasma membrane and contributes to succinate transport. After PMA treatment, a broad staining was observed below the plasma membrane, indicating a retrieval of fNaDC-3 to a submembraneous compartment, probably endosomes. These findings correspond well with the PKC-mediated downregulation of the phosphate transporter NaPi-2 also expressed in oocytes (11) and explain the decrease in ΔImax without significant changes in Km as determined in our electrophysiological experiments. A decrease in surface expression by 32% was observed for rbNaDC-1 after 50 nM PMA (26). In an attempt to clarify the mechanism of endocytosis, we tested the effects of 20 μM cytochalasin D and 20 μM colchicine, inhibitors of the cytoskeleton, on the PMA-induced reduction of succinate transport (data not shown). Neither compound influenced the [14C]succinate uptake in the absence or presence of PMA. These results are different from data on the rabbit luminal NaDC-1, where cytochalasin D partly prevented the inhibitory effects of PMA. It must be clarified whether this difference is due to a species difference between flounder and rabbit or to a difference between luminal and basolateral transporters. Further experiments are needed to characterize the mechanism of endocytosis in more detail. To test the effect of cytochalasin D and colchicine in oocytes, we measured the protein release by cortical granule exocytosis with PMA and 20 μM cytochalasin D or PMA and 20 μM colchicine. The exocytotic process induced by PMA was inhibited to 8.1 ± 1.6% by cytochalasin D and to 7.9 ± 1.9% by colchicine, respectively. The results show the inhibition of exocytosis by cytochalasin D and colchicine, whereas the endocytostic process induced by PKC remains unaffected.

In conclusion, our results show a downregulation of the NaDC-3 transport function by PKC activation. This downregulation of dicarboxylate uptake could lead to a restriction of disposable energy. Interestingly, stimulation of PKC in renal proximal tubule cells appears to play an important role in the pathophysiology of acute renal failure (21). Aminoglycoside antibiotics, radiocontrast agents, as well as heavy metals are nephrotoxicants, which induce a release of endothelin from renal proximal tubule cells. Endothelin binds to an endothelin type B receptor and triggers a signal cascade including nitric oxide synthase, which finally activates PKC. Activation of PKC initiates a downregulation of the activity, of xenobiotic export pumps, P-glycoprotein, and multidrug resistance-associated protein 2, causing intracellular accumulation of potentially toxic substances. The downregulation of sodium-coupled dicarboxylate transporters could add on this toxic effect by partial energy deprivation of proximal tubule cells.

FOOTNOTES

  • The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank S. Schindelmann for technical assistence, A. Nolte (Department of Biochemistry) for the nucleotide sequencing, and E. Thelen for expert help with the preparation of the illustrations.

GRANTS

We thank Deutsche Forschungsgemeinschaft (DFG) for supporting the project with DFG Grants Ste 435/2-4, Bu 571/7-5, and Bu 998/2-2.

References

  • 1 Bement WM and Capco GD. Activators of protein kinase C trigger cortical granule exocytosis, cortical concentration, and cleavage furrow formation in Xenopus laevis oocytes and eggs. J Cell Biol 108: 885-892, 1989.
    Crossref | PubMed | ISI | Google Scholar
  • 2 Burckhardt BC, Drinkuth B, Menzel C, König A, Steffgen J, Wright SH, and Burckhardt G. The renal Na+-dependent dicarboxylate transporter, NaDC-3, translocates dimethyl- and disulfhydryl-compounds and contributes to renal heavy metal detoxification. J Am Soc Nephrol 13: 2628-2638, 2002.
    Crossref | PubMed | ISI | Google Scholar
  • 3 Burckhardt G, Bahn A, and Wolff NA. Molecular physiology of renal p-aminohippurate secretion. News Physiol Sci 16: 114-118, 2001.
    Abstract | Google Scholar
  • 4 Casado M, Bendahan A, Zafra F, Danbolt NC, Aragon C, Gimenez C, and Kanner BI. Phosphorylation and modulation of brain glutamate transporters by protein kinase C. J Biol Chem 268: 27313-27317, 1993.
    PubMed | ISI | Google Scholar
  • 5 Chen WX, Zhu H, Peng L, Hong Q, Zhang Li, and Shi S. Expressions of sodium/dicarboxylate cotransporter in basolateral membranes of tubular proximal epithelial cells of kidneys increased with aging in both wister rats and normal people as detected with antifusion protein antibody (Abstract). J Am Soc Nephrol 13: F-P0027, 2002.
    Google Scholar
  • 6 Chen X, Tsukaguchi H, Chen XZ, Berger UV, and Hediger MA. Molecular and functional analysis of SDCT2, a novel rat sodium-dependent dicarboxylate transporter. J Clin Invest 103: 1159-1168, 1999.
    Crossref | PubMed | ISI | Google Scholar
  • 7 Chen XZ, Shayakul C, Berger UV, Tian W, and Hediger MA. Characterization of a rat Na+-dicarboxylate cotransporter. J Biol Chem 273: 20972-20981, 1998.
    Crossref | PubMed | ISI | Google Scholar
  • 8 Conradt M and Stoffel W. Inhibition of the high-affinity brain glutamate transporter GLAST-1 via direct phosphorylation. J Neurochem 68: 1244-1251, 1997.
    Crossref | PubMed | ISI | Google Scholar
  • 9 Daniels GM and Amara SG. Regulated trafficking of the human dopamine transporter. Clathrin-mediated internalization and lysosomal degradation in response to phorbol esters. J Biol Chem 274: 35794-35801, 1999.
    Crossref | PubMed | ISI | Google Scholar
  • 10 Doolen S and Zahniser NR. Conventional protein kinase C isoforms regulate human dopamine transporter activity in Xenopus oocytes. FEBS Lett 516: 187-190, 2002.
    Crossref | PubMed | ISI | Google Scholar
  • 11 Forster IC, Traebert M, Jankowski M, Stange G, Biber J, and Murer H. Protein kinase C activators induce membrane retrieval of type II Na+-phosphate cotransporters expressed in Xenopus oocytes. J Physiol 517: 327-340, 1999.
    Crossref | PubMed | ISI | Google Scholar
  • 12 Hayes G, Busch AE, Lang F, Biber J, and Murer H. Protein kinase C consensus sites and the regulation of renal Na/Pi-cotransport (NaPi-2) expressed in Xenopus laevis oocytes. Pflügers Arch 430: 819-824, 1995.
    Crossref | PubMed | ISI | Google Scholar
  • 13 Hentschel H, Burckhardt BC, Schölermann B, Kühne L, Burckhardt G, and Steffgen J. Basolateral localization of flounder Na+-dicarboxylate cotransporter (fNaDC-3) in the kidney of Pleuronectes americanus. Pflügers Arch 446: 578-584, 2003.
    Crossref | PubMed | ISI | Google Scholar
  • 14 Hirsch JR, Loo DD, and Wright EM. Regulation of Na+/glucose cotransporter expression by protein kinases in Xenopus laevis oocytes. J Biol Chem 271: 14740-14746, 1996.
    Crossref | PubMed | ISI | Google Scholar
  • 15 Huang W, Wang H, Kekuda R, Fei YJ, Friedrich A, Wang J, Conway SJ, Cameron RS, Leibach FH, and Ganapathy V. Transport of N-acetylaspartate by the Na+-dependent high-affinity dicarboxylate transporter NaDC3 and its relevance to the expression of the transporter in the brain. J Pharmacol Exp Ther 295: 392-403, 2000.
    PubMed | ISI | Google Scholar
  • 16 Kazanietz GM. Novel “nonkinase” phorbol ester receptors: the C1 domain connection. Mol Pharmacol 61: 759-767, 2002.
    Crossref | PubMed | ISI | Google Scholar
  • 17 Kekuda R, Wang H, Huang W, Pajor AM, Leibach FH, Devoe LD, Prasad PD, and Ganapathy V. Primary structure and functional characteristics of a mammalian sodium-coupled high affinity dicarboxylate transporter. J Biol Chem 274: 3422-3429, 1999.
    Crossref | PubMed | ISI | Google Scholar
  • 18 Knauf F, Rogina B, Jiang Z, Aronson PS, and Helfand SL. Functional characterization and immunolocalization of the transporter encoded by the life-extending gene Indy. Proc Natl Acad Sci USA 99: 14315-14319, 2002.
    Crossref | PubMed | ISI | Google Scholar
  • 19 Mehrens T, Lelleck S, Cetinkaya I, Knollmann M, Hohage H, Gorboulev V, Boknik P, Koepsell H, and Schlatter E. The affinity of the organic cation transporter rOCT1 is increased by protein kinase C-dependent phosphorylation. J Am Soc Nephrol 11: 1216-1224, 2000.
    PubMed | ISI | Google Scholar
  • 20 Melikian HE and Buckley KM. Membrane trafficking regulates the activity of the human dopamine transporter. J Neurosci 19: 7699-7710, 1999.
    Crossref | PubMed | ISI | Google Scholar
  • 21 Miller DS. Xenobiotic export pumps, endothelin signaling, and tubular nephrotoxicants-a case of molecular hijacking. J Biochem Mol Toxicol 16: 121-127, 2002.
    Crossref | PubMed | ISI | Google Scholar
  • 22 Pajor AM. Sequence and functional characterization of a renal sodium/dicarboxylate cotransporter. J Biol Chem 270: 5779-5785, 1995.
    Crossref | PubMed | ISI | Google Scholar
  • 23 Pajor AM. Molecular properties of sodium/dicarboxylate cotransporters. J Membr Biol 175: 1-8, 2000.
    Crossref | PubMed | ISI | Google Scholar
  • 24 Pajor AM, Gangula R, and Yao X. Cloning and functional characterization of a high-affinity Na+/dicarboxylate cotransporter from mouse brain. Am J Physiol Cell Physiol 280: C1215-C1223, 2001.
    Link | ISI | Google Scholar
  • 25 Pajor AM and Sun N. Characterization of the rabbit renal Na+-dicarboxylate cotransporter using antifusion protein antibodies. Am J Physiol Cell Physiol 271: C1808-C1816, 1996.
    Link | ISI | Google Scholar
  • 26 Pajor AM and Sun N. Protein kinase C-mediated regulation of the renal Na+/dicarboxylate cotransporter, NaDC-1. Biochim Biophys Acta 1420: 223-230, 1999.
    Crossref | PubMed | ISI | Google Scholar
  • 27 Quick MW, Corey JL, Davidson N, and Lester HA. Second messengers, trafficking-related proteins, and amino acid residues that contribute to the functional regulation of the rat brain GABA transporter GAT1. J Neurosci 17: 2967-2979, 1997.
    Crossref | PubMed | ISI | Google Scholar
  • 28 Rogina B, Reenan RA, Nilsen SP, and Helfand SL. Extended life-span conferred by cotransporter gene mutations in Drosophila. Science 290: 2137-2140, 2000.
    Crossref | PubMed | ISI | Google Scholar
  • 29 Röver N, Kramer C, Stark U, Gabriels G, and Greven J. Basolateral transport of glutarate in proximal S2 segments of rabbit kidney: kinetics of the uptake process and effect of activators of protein kinase A and C. Pflügers Arch 436: 423-428, 1998.
    Crossref | PubMed | ISI | Google Scholar
  • 30 Sato K, Adams R, Betz H, and Schloss P. Modulation of a recombinant glycine transporter (GLYT1b) by activation of protein kinase C. J Neurochem 65: 1967-1973, 1995.
    Crossref | PubMed | ISI | Google Scholar
  • 31 Sato K, Betz H, and Schloss P. The recombinant GABA transporter GAT1 is downregulated upon activation of protein kinase C. FEBS Lett 375: 99-102, 1995.
    Crossref | PubMed | ISI | Google Scholar
  • 32 Sekine T, Cha SH, Hosoyamada M, Kanai Y, Watanabe N, Furuta Y, Fukuda K, Igarashi T, and Endou H. Cloning, functional characterization, and localization of a rat renal Na+-dicarboxylate transporter. Am J Physiol Renal Physiol 275: F298-F305, 1998.
    Link | ISI | Google Scholar
  • 33 Shank RP and Campbell GL. Glutamine and α-ketoglutarate uptake and metabolism by nerve terminal enriched material from mouse cerebellum. Neurochem Res 7: 601-616, 1982.
    Crossref | PubMed | ISI | Google Scholar
  • 34 Steffgen J, Burckhardt BC, Langenberg C, Kühne L, Müller GA, Burckhardt G, and Wolff NA. Expression cloning and characterization of a novel sodium-dicarboxylate cotransporter from winter flounder kidney. J Biol Chem 274: 20191-20196, 1999.
    Crossref | PubMed | ISI | Google Scholar
  • 35 Wang H, Fei YJ, Kekuda R, Yang-Feng TL, Devoe LD, Leibach FH, Prasad PD, and Ganapathy V. Structure, function, and genomic organization of human Na+-dependent high-affinity dicarboxylate transporter. Am J Physiol Cell Physiol 278: C1019-C1030, 2000.
    Link | ISI | Google Scholar
  • 36 Wilkinson SE, Parker PJ, and Nixon JS. Isoenzyme specificity of bisindolylmaleimides, selective inhibitors of protein kinase C. Biochem J 294: 335-337, 1993.
    Crossref | PubMed | ISI | Google Scholar
  • 37 Wolff NA, Grünwald B, Friedrich B, Lang F, Godehardt S, and Burckhardt G. Cationic amino acids involved in dicarboxylate binding of the flounder renal organic anion transporter. J Am Soc Nephrol 12: 2012-2018, 2001.
    PubMed | ISI | Google Scholar
  • 38 Wolff NA, Thies K, Kuhnke N, Reid G, Friedrich B, Lang F, and Burckhardt G. PKC activation downregulates hOAT1-mediated transport by carrier internalization. J Am Soc Nephrol 14: 1959-1968, 2003.
    Crossref | PubMed | ISI | Google Scholar
  • 39 Zhang FF and Pajor AM. Topology of the Na+/dicarboxylate cotransporter: the N-terminus and hydrophilic loop 4 are located intracellularly. Biochim Biophys Acta 1511: 80-89, 2001.
    Crossref | PubMed | ISI | Google Scholar
  • 40 Zhu SJ, Kavanaugh MP, Sonders MS, Amara SG, and Zahniser NR. Activation of protein kinase C inhibits uptake, currents and binding associated with the human dopamine transporter expressed in Xenopus oocytes. J Pharmacol Exp Ther 282: 1358-1365, 1997.
    PubMed | ISI | Google Scholar

AUTHOR NOTES

  • Address for reprint requests and other correspondence: Y. Hagos, Zentrum Physiologie und Pathophysiologie, Abt. Vegetative Physiologie und Pathophysiologie, Universität Göttingen, Humboldtallee 23, 37073 Göttingen, Germany (E-mail: ).