Contraction-induced increases in Na+-K+-ATPase mRNA levels in human skeletal muscle are not amplified by activation of additional muscle mass
Abstract
The present study tested the hypothesis that exercise with a large compared with a small active muscle mass results in a higher contraction-induced increase in Na+-K+-ATPase mRNA expression due to greater hormonal responses. Furthermore, the relative abundance of Na+-K+-ATPase subunit α1, α2, α3, α4, β1, β2, and β3 mRNA in human skeletal muscle was investigated. On two occasions, eight subjects performed one-legged knee extension exercise (L) or combined one-legged knee extension and bilateral arm cranking (AL) for 5.00, 4.25, 3.50, 2.75, and 2.00 min separated by 3 min of rest. Leg exercise power output was the same in AL and L, but heart rate at the end of each exercise interval was higher in AL compared with L. One minute after exercise, arm venous blood lactate was higher in AL than in L. A higher level of blood epinephrine and norepinephrine was evident 3 min after exercise in AL compared with L. Nevertheless, none of the exercise-induced increases in α1, α2, β1, and β3 mRNA expression levels were higher in AL compared with L. The most abundant Na+-K+-ATPase subunit at the mRNA level was β1, which was expressed 3.4 times than α2. Expression of α1, β2, and β3 was less than 5% of the α2 expression, and no reliable detection of α3 and α4 was possible. In conclusion, activation of additional muscle mass does not result in a higher exercise-induced increase in Na+-K+-ATPase subunit-specific mRNA.
the na+-k+-atpase plays an important role in the regulation of potassium in contracting muscles, and thereby systemic levels, during exercise (8). Therefore, an upregulation of Na+-K+-ATPase content in exercise-trained muscles (8, 28, 32, 42) is likely to cause the observed training-induced reduction of plasma (18) and interstitial K+ accumulation during exercise and the concomitant enhanced exercise performance (32). Nevertheless, not until recently has the subunit-specific adaptation of the Na+-K+-ATPase to exercise and a period of training been studied at the protein (9, 15, 32) and mRNA level (33). In a previous study of high-intensity exercise, we found an increase in α1 mRNA but did not detect increases in α2 and β1 mRNA (33). In that study, expression of α1 and α2 protein increased, whereas β1 was unchanged after a period of training (32). One study has investigated α3, β2, and β3 mRNA after intense exercise in humans (29), and increases in mRNA for these subunits as well as for α1, α2, and β1 were found, whereas no change in protein expression was detected. Resistance training for 6 wk has been shown to increase α1, α2, and β1 protein expression (9), and 6 days of prolonged cycle training have resulted in a higher α2 and β1 but not α1 protein expression (15). Thus the effect of exercise on Na+-K+-ATPase subunit expression at the protein and mRNA level varies between studies, possibly dependent on the active muscle mass as well as the intensity and duration of the exercise investigated. In addition, methodological variation is seemingly larger in studies of mRNA changes (29, 33, 37) than the more traditional approach using [3H]ouabain to quantify non-subunit-specific changes in Na+-K+-ATPase protein expression (8). One mRNA transcript consistently reported to increase with exercise of various types is pyruvate dehydrogenase kinase 4 (PDK4) (35). Thus analysis of PDK4 mRNA is a sensible positive control for ascertaining that an exercise-induced mRNA change is detected if present.
Hormones, such as catecholamines and insulin, are important regulators of Na+-K+-ATPase activity (8). Furthermore, several hormones are potent regulators of Na+-K+-ATPase expression (12). It can be hypothesized that during high-intensity exercise, the size of the active muscle mass and the concomitant hormonal response will affect the exercise-induced upregulation of Na+-K+-ATPase expression. The major endocrine regulator of Na+-K+-ATPase basal expression seems to be thyroid hormone (8), but cortisol and possibly growth hormone (GH) also affect Na+-K+-ATPase expression (8, 11, 12, 45). Furthermore, hormonal induction of Na+-K+-ATPase subunit expression may be subunit specific, as evidenced by the selective upregulation of α2 and β1 mRNA and protein expression shown by analysis of α1, α2, β1, and β2 expression in rat skeletal muscle after treatment with the artificial glucocorticoid dexamethasone (46). Furthermore, treatment with dexamethasone has been shown to result in a dose-dependent increase in [3H]ouabain binding sites in rat skeletal muscle (10, 39), confirming that changes at the mRNA level are likely to cause changes in Na+-K+-ATPase protein expression. Plasma levels of thyroid hormone do not change with exercise (13, 43), but both cortisol (5, 47, 48) and GH (14) increase during and after exercise. The increases in cortisol and GH seem to be largest with intense exercise of a long duration (5, 14, 47, 48). Therefore, the largest effect of an exercise-associated hormone-induced upregulation of Na+-K+-ATPase expression may be expected when performing high-intensity exercise engaging a large muscle mass for a substantial duration. However, it has been argued that hormones are not important for the exercise-induced upregulation of Na+-K+-ATPase content because adaptation after a period of exercise training only occurs in the exercise-trained and not in the nontrained muscles (8, 25, 44). On the other hand, this argument does not take into account that blood flow increases up to ∼20-fold in the active musculature during intense exercise (2), resulting in a substantially increased availability of circulating hormones to the exercising muscles compared with the inactive muscles, and therefore a muscle may have to be activated to adapt. Thus there is a need to examine the effect of the active muscle mass on Na+-K+-ATPase subunit adaptation to exercise.
In homogenates of human skeletal muscle, expression of Na+-K+-ATPase isoforms α1, α2, α3, β1, β2, and β3 protein and mRNA has been reported (29) as well as expression of α4 mRNA (23). Nevertheless, other studies have not been able to detect α3 and α4 mRNA (20, 41), and the β2 protein has not been observed in membrane fractions of muscle cells (19, 22), possibly because of a general low expression level or because of low protein recovery during fractionation (17). When investigating and interpreting the physiological importance of exercise-induced relative changes of the Na+-K+-ATPase subunit mRNA levels, it is important to know the basal subunit-specific abundance. Previously, only fold changes have been reported (29, 33). Data on the relative abundance of Na+-K+-ATPase subunit mRNA in human skeletal muscle do not exist, but from rat muscle it is known that α2 and unspecified β mRNA are the most abundant, followed by α1 mRNA (34). At the protein level, β1 is the most abundant subunit, followed by α2 and then α1 (26). A similar difference in the abundance of Na+-K+-ATPase subunits can be expected in human skeletal muscle. Thus information about basal mRNA expression levels can help to clarify the uncertainties regarding the expression of Na+-K+-ATPase isoforms in human skeletal muscle and provide important knowledge about how to interpret the physiological importance of fold changes in Na+-K+-ATPase mRNA levels after exercise.
Therefore, the purpose of the present study was to evaluate the hypothesis that intense intermittent exercise with a large active muscle mass induces a greater change in Na+-K+-ATPase mRNA expression in an active muscle than when exercise is carried out with a smaller total active muscle mass. A second aim was to quantify the relative amount of the various Na+-K+-ATPase subunit mRNAs in resting human skeletal muscle.
METHODS
Eight male recreationally active subjects [24 ± 12 (mean ± SD) yr, 76.5 ± 9.0 kg] participated in the study after giving their informed consent. The study conforms to the code of Ethics of the World Medical Association (Declaration of Helsinki) and was approved by the Ethics Committee of Copenhagen and Frederiksberg communities (KF 01-183/02).
Exercise Protocols
Each subject completed at least three pretrials separated by 8 ± 3 days, to get acquainted with the protocol and exercise model. In one of two experimental sessions, subjects performed intermittent, one-legged knee extensor exercise (1) at a rate of 60 contractions/min in an upright sitting position (L). Subjects exercised for 5, 4.25, 3.50, 2.75, and 2 min separated by 3 min of rest. The leg power output (56 ± 5 W) was determined during pretrials to result in fatigue after 6–7 min of exercise. In the other experimental session, subjects performed the L protocol as well as concomitant bilateral arm cranking (82 ± 18 W) at 60 rpm on a modified Monark ergometer (AL). The workload for the arm exercise was determined in pretrials to result in the highest possible heart rate after 6–7 min (maximal heart rate) of combined arm and leg exercise. A standardized meal was given to the subjects on the evening and morning before the experiments. All experiments were initiated in the morning (9:28 AM ± 1 h). The order of the two experimental sessions was randomized, and the experiments were completed at least 2 wk apart (mean: 24 ± 9 days). The first experimental day was a minimum of 4 days after (mean: 18 ± 17 days) the last pretrial.
A muscle biopsy was obtained from vastus lateralis muscle at rest and at 0, 1, 3, and 5 h after the last exercise interval. Biopsies were obtained from the same leg after L and AL exercise. Blood was drawn from an antecubital vein at rest and 1 min after each exercise period as well as 3 and 16 min after the final exercise period. The muscle biopsies were analyzed for mRNA expression (n = 8), and the blood samples were analyzed for lactate (n = 8) and catecholamines (n = 4). Heart rate was measured continuously during exercise with a Polar heart rate monitor. The kicking frequency was recorded by a computer.
Analysis
RNA isolation.
From each biopsy, two ∼25-mg wet weight muscle tissue samples were used for duplicate RNA extraction by a modified guanidinium thiocyanate-phenol-chloroform extraction method (7) as described previously (36). Briefly, the samples were homogenized in the guanidinium thiocyanate solution. Extraction was performed by centrifugation after adding sodium acetate, pH 4.0, diethyl pyrocarbonate-saturated phenol, and chloroform-isoamyl alcohol. RNA was precipitated by centrifugation after addition of isopropanol. The pellet was then rinsed with 75% ethanol and resuspended in 50 μl of nuclease-free water containing 0.1 mM EDTA. The quality of the extracted RNA was ensured by detection of 18S and 28S bands using electrophoresis (formaldehyde- and ethidium bromide-containing 2.5% agarose gel). Furthermore, the ratio of absorbance at 260 and 280 nm (260/280) was >1.7.
Reverse transcription.
The reverse transcription reaction was performed using the Superscript II RNase H− system and Oligo dT primers as described by the manufacturer (Invitrogen, Carlsbad, CA). A volume of 11 μl of RNA was reverse transcribed, and the reverse transcription product was diluted in nuclease-free water to a total volume of 150 μl.
Real-time PCR.
Specific primers and probes were designed for each of the mRNA sequences of interest (Table 1). The cDNA sequences and information on exon/intron boundaries were obtained from the National Center for Biotechnology Information (NCBI) and Sanger Centre databases. Primers and probes were designed using Primer Express v. 2.0 (Applied Biosystems). Probes were labeled with 6-carboxyfluorescein at the 5′ end and 6-carboxy-N,N,N′,N′-tetramethylrhodamine at the 3′ end. Specificity of the obtained product sequence was confirmed by a search in the NCBI BLAST database. It was verified that amplification of RNA samples not subjected to reverse transcription did not result in a detectable PCR product within the cycle numbers used for analysis of mRNA expression. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA content was determined using commercially available primers and probes (Applied Biosystems). Primer and probe optimization and validation of amplification efficiency (Table 1) were carried out. Validation of the different PCR product sizes was performed by electrophoresis (ethidium bromide-containing 2.5% agarose gel). The ABI 7900 real-time PCR system was used for relative quantification. Each reaction was composed of 1 μl of the diluted cDNA and 5 μl of 2× TaqMan Universal MasterMix [AmpliTaq Gold DNA polymerase, AmpErase UNG (uracil N-glycosylase), dNTPs with dUTP, buffer components, ROX as passive reference; Applied Biosystems]. Primers, probe and water were added to give a final reaction volume of 10 μl per well. Triplicate analyses were performed for each PCR reaction. Analysis of expression in each of the two samples obtained per biopsy was performed in separate runs. Before PCR cycling, incubation at 50°C for 2 min followed by 95° for 10 min was performed to activate the UNG enzyme and AmpliTaq Gold enzyme, respectively. PCR cycling was performed by heating to 95°C for 15 s followed by 60°C for 60 s. A total of 50 cycles was completed.
| Gene | Forward Primer | Reverse Primer | Probe | Efficiency | Exon | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Na+-K+-ATPase subunit | ||||||||||
| α1 | AAAAACATGGTCCCTCAGCAA | CCACAACTTCCTCCGCATTT | CCCTTGTGATTCGAAATGGTGAGAAAATGA | 1.98 | 4/5 | |||||
| α2 | GAATGAGAGGCTCATCAGCATG | CAAAGTAGGTGAAGAAGCCACCC | CCTACGGACAGATCGGGATGATCCAG | 1.90 | 18/19 | |||||
| α3 | AATGCCTACCTTGAGCTCGG | CTCGGGCAGGTAATAATGGC | CTGGGCGAGCGCGTGCTTG | 1.91 | 12/13 | |||||
| α4 | GATGATCACAAATTAACCTTGGAAGA | TTTGCCCTTTGGTGGCTATG | CACCAAGTACTCCGTGGACCTGACAAAGG | 1.84 | 2/3 | |||||
| β1 | TCAGTGAATTTAAGCCCACATATCA | CTTCTGGATCTGAGGAATCTGTGTT | CGAGTGGCCCCGCCAGGAT | 1.85 | 2/3 | |||||
| β2 | CCAGCATGTTCAGAAGCTCAAC | GCGGCAGACATCATTCTTTTG | AGTTCTTGGAGCCTTACAACGACTCTATCCAAGC | 1.91 | 3/4 | |||||
| β3 | CTGGCCGAGTGGAAGCTC | GGTGCGCCCCAGGAA | TCATCTACAACCCGACCACCGGAGA | 1.74 | 1 | |||||
| PDK4 | TCCACTGCACCAACGCCT | TGGCAAGCCGTAACCAAAA | ATAATTCCCGGAATGCTCCTTTGGCTG | 1.95 | 9/10 | |||||
PCR data analysis.
The cycle at which the fluorescence signal rises above a manually chosen threshold level is defined as the threshold cycle (CT). With the use of a standard curve, an arbitrary mRNA amount was calculated from the CT value.
Quantification of relative mRNA abundance.
To evaluate the relative expression level of the Na+-K+-ATPase subunit mRNAs in human skeletal muscle, we performed additional PCR runs of the 32 cDNA samples obtained from biopsies taken at rest. Oligonucleotides identical to each of the expected PCR amplicons were synthesized by TAG Copenhagen, serial diluted, and used as standards. Amplification efficiency of the primer/probe set was verified to be the same when a reverse-transcribed RNA sample was analyzed as when a synthetic standard sample was analyzed.
cDNA quantification.
To circumvent the problems associated with the use of endogenous controls, such as GADPH (6), the amount of RNA:cDNA hybrids (dsHybrids) in each reverse-transcribed sample was determined with the PicoGreen reagent (Molecular Probes) and subsequently used for normalization (Lundby C and Pilegaard H, unpublished observations). Each sample was run in triplicates composed of 2.5 μl of RNA:cDNA template, 97.5 μl of Tris-EDTA (TE) buffer, and 100 μl of 200× TE-diluted PicoGreen reagent in each well. With the use of a Fluoroskan Ascent (Thermo Labsystems), the 96-well microtiter plate was shaken at 250 rpm for 10 s and then incubated for 5 min followed by measurement of the fluorescence emission intensity at 520 nm with excitation at 480 nm. The mean reading for each triplicate was converted to an absolute amount by using a standard curve constructed from a serial dilution (ranging from 1 to 10 ng) of bacteriophage lambda DNA standard (Molecular Probes).
Blood analysis.
Catecholamines were measured using a radioimmunoassay (RIA) kit from Biotech. Blood lactate was analyzed using a lactate analyzer (model 23; Yellow Springs Instruments).
Statistics and Calculations
All target gene-to-dsHybrid ratios were normalized to the resting sample ratio. A previous study from our group (33) showed a high variability in mRNA data. Thus the average of the duplicate determination of expression in each biopsy was used for further calculations. Before statistical analyses were performed, all mRNA expression data were logarithmically transformed to obtain a data set with normal distribution. The level of significance was set to P < 0.05. Because of the logarithmic transformation for the statistical analyses, the data reported in the text and shown on graphs are the antilogarithmic values (geometric mean) and 95% confidence intervals of the target gene-to-dsHybrid amount normalized to the ratio of the presample. All data other than mRNA expression data are reported as means ± SD. Differences between time points and exercise modes have been calculated using a one- or two-way ANOVA for repeated measurements followed by Tukey's post hoc test, as appropriate.
RESULTS
Na+-K+-ATPase mRNA Levels in Resting Human Skeletal Muscle
All of the investigated Na+-K+-ATPase subunit mRNAs were expressed at different levels in human skeletal muscle (P < 0.001). Of the catalytic α-subunits, the most abundant was α2 mRNA followed by α1 mRNA, which was expressed at a level corresponding to 5% of the α2 mRNA expression (Fig. 1). The expression level of α3 and α4 mRNAs corresponded to less than 1 molecule/μl in the analyzed volume. Thus these subunits were not expressed at a level that allowed reliable detection. As shown in Fig. 1, β1 mRNA was the most highly expressed of all subunits, exceeding the α2 mRNA expression by 3.4-fold. The β2 and β3 mRNA expression was <1% of the β1 mRNA expression.
Fig. 1.Expression of Na+-K+-ATPase subunit mRNA in resting human skeletal muscle. Biopsies were obtained from 8 male subjects at rest on 2 different occasions. Each biopsy was analyzed in duplicate. For each subject, the average expression of the 4 samples was converted to an absolute amount of molecules by using a standard curve generated using a synthetic oligonucleotide corresponding to the target sequence, resulting in an amount of target sequence molecules. Data are normalized to the content of RNA:cDNA hybrids (dsHybrids; ng) in the cDNA sample used for PCR (see methods). Data points represent individual average expression. All expression levels are different from each other (P < 0.001).
Physiological Response to Leg Exercise With or Without Simultaneous Arm Exercise
There was no difference in leg power output between AL and L exercise (57 ± 5 vs. 59 ± 5 W). Heart rate at the end of exercise was higher (P < 0.001) in AL than in L (91 ± 3 vs. 61 ± 12% of maximal heart rate). At the end of each exercise period, arm venous blood lactate concentration was on average 2.6-fold higher (P < 0.001) in AL compared with L, reaching 11.4 ± 4.2 and 4.2 ± 2.2 mM 1 min after the last exercise period in AL and L, respectively. Furthermore, 3 min after the final exercise period, a higher concentration of both epinephrine (141%; P = 0.012) and norepinephrine (380%; P = 0.028) existed in AL than in L (Fig. 2), whereas 16 min after exercise, the differences in epinephrine (72%) and norepinephrine (72%) were not significant (n = 4).
Fig. 2.Concentration of epinephrine (A) and norepinephrine (B) in blood sampled from an antecubital vein 3 and 16 min after completion of 5 intense exercise intervals. One-legged high-intensity intermittent knee extensor exercise was carried out with (open bars; AL) or without (solid bars; L) simultaneous arm exercise. Values are means ± SD; n = 4. *P < 0.05 compared with L.
Exercise-Induced Changes in Na+-K+-ATPase mRNA Levels
An exercise-induced increase (P < 0.001) in α1 mRNA expression was evident 1, 3, and 5 h into recovery in both AL and L with no differences between AL and L (Fig. 3). In addition, exercise induced an increase (P < 0.001) in α2 mRNA expression. In AL, an increase in α2 mRNA was apparent after 1 and 3 h of recovery, whereas an increase was observed at 1, 3, and 5 h of recovery in L (Fig. 3), with no differences between AL and L.
Fig. 3.High-intensity exercise-induced alterations in muscle Na+-K+-ATPase subunit α1 (A) and α2 (B) mRNA levels during a 5-h recovery period after exercise. One-legged high-intensity intermittent knee extensor exercise was carried out with (open bars; AL) or without (solid bars; L) simultaneous arm exercise. Expression after exercise is normalized to expression at rest. Values are geometric means and 95% confidence intervals. Changes in AL or L significantly different from the preexercise value are indicated: *P < 0.05; **P < 0.01; ***P < 0.001.
The level of β1 mRNA increased (P < 0.001) after exercise, being evident after 1 and 3 h of recovery in AL and after 1, 3, and 5 h of recovery in L (Fig. 4). At 5 h, the level of β1 was higher (P = 0.020) in L compared with AL (1.5- vs. 2.4-fold). No exercise-induced increase in β2 mRNA expression could be determined at any time point after exercise (Fig. 4), whereas an increase (P < 0.001) in β3 mRNA after exercise was detected at all time points after both AL and L exercise (Fig. 4). No difference in the exercise-induced increase in β3 existed between AL and L.
Fig. 4.High-intensity exercise-induced alterations in muscle Na+-K+-ATPase β1 (A), β2 (B), and β3 (C) mRNA levels during a 5-h recovery period after exercise. One-legged high-intensity intermittent knee-extensor exercise was carried out with (open bars; AL) or without (solid bars; L) simultaneous arm exercise. Expression after exercise is normalized to expression at rest. Values are geometric means and 95% confidence intervals. Changes in AL or L significantly different from the preexercise value are indicated: *P < 0.05; **P < 0.01; ***P < 0.001; $P < 0.05, AL vs. L response.
Exercise-Induced Changes in PDK4 and GAPDH mRNA Expression
GAPDH mRNA tended to be elevated (P = 0.080) after exercise, with no differences between AL and L (Fig. 5). Exercise induced an increase (P < 0.001) in PDK4 mRNA (Fig. 5), with no differences between AL and L. At the end of L exercise, PDK4 mRNA was ∼5-fold (P = 0.028) higher than before exercise, and it was ∼21-fold higher (P < 0.001) 5 h into the recovery period. For AL exercise, PDK4 mRNA was elevated ∼8-fold (P = 0.002) after 5 h of recovery.
Fig. 5.Intermittent high-intensity exercise-induced alterations in muscle pyruvate dehydrogenase kinase 4 (PDK4; A) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; B) mRNA levels. One-legged knee-extensor exercise was carried out with (open bars; AL) or without (solid bars; L) simultaneous arm exercise. Values are geometric means and 95% confidence intervals. Changes in AL or L significantly different from the preexercise value are indicated: *P < 0.05; **P < 0.01; ***P < 0.001.
DISCUSSION
The findings in the present study could not support the hypothesis that exercising with an additional large muscle mass induces a higher increase in the Na+-K+-ATPase subunit mRNA expression of an exercising muscle. We also found that the Na+-K+-ATPase subunits α2 and β1 are the most highly expressed at the mRNA level in human skeletal muscle, followed by α1, β2, and β3. The levels of α3 and α4 did not allow for a reliable detection.
Exercise with a large compared with a small muscle mass did not induce any difference in the mRNA expression level during recovery for any of the investigated subunits, except at 5 h after exercise, when the expression of β1 mRNA was lower for AL compared with L. In preliminary studies, we observed the intra- and interindividual coefficient of variation to be ∼30% for α1, α2, and β1 mRNA expression in human skeletal muscle. The substantial, but typical, variation in mRNA expression data (29, 30, 33, 37) underlines the need for caution when interpreting data where no differences are found. In the present study, we used duplicate RNA isolations from each biopsy specimen and normalization of target mRNA amount to the amount of RNA:cDNA hybrids in the sample used for real-time PCR. This was done to increase the power of the applied analysis and to circumvent the problem of using endogenous controls that possibly can be affected by exercise (6, 30). Thus differences of ∼0.7-fold in mRNA expression between AL and L exercise would have been detected as revealed by a power analysis. The lack of a higher Na+-K+-ATPase subunit mRNA expression after AL compared with L exercise is not likely to have been caused by an insufficient difference in the physiological response between AL and L. The epinephrine and norepinephrine concentrations 3 min after exercise were 141 and 380% higher for AL than for L. The exercise intensity was ∼90% of maximal oxygen consumption (V̇o2 max) for AL and ∼60% of V̇o2 max for L, as estimated from the heart rate response during exercise. Previously, plasma cortisol has been shown to increase from a resting level of ∼135–275 nM and reach ∼550 nM after intermittent high-intensity cycling of duration and intensity comparable to that of AL exercise (16, 27), whereas plasma cortisol has been reported to be less than ∼275 nM after intermittent exercise at an intensity <70% of V̇o2 max (27). Furthermore, exercise at intensities >60% of V̇o2 max is generally suggested to be required to elicit an exercise-induced increase in GH (14), and as little as 1.5 min of exhaustive running has been shown to increase GH 35% (24). Therefore, it seems valid to assume that both cortisol and GH levels were higher for AL than for L both during and after exercise. From these results, it appears reasonable to conclude that higher hormonal responses brought about by activation of additional muscle mass do not amplify mRNA expression of Na+-K+-ATPase subunits after intense exercise.
In addition to the systemic effects, it is likely that differences in intracellular ion homeostasis of the active muscle cells existed between AL and L exercise. In a previous study in which intense knee extensor exercise was performed after a period of intense intermittent arm exercise, it was observed that lactate release from the leg muscle was reduced, K+ release was elevated, and muscle pH in the quadriceps muscle was lowered (3). A lower pH may have affected Na+-K+-ATPase subunit gene expression by inducing changes in intracellular Na+ concentration (31) by reducing the open probability of Na+ channels (40) or increasing Na+/H+ exchange (21). In addition, changes in intracellular Ca2+ homeostasis endorsed by changes in intracellular Na+ and, subsequently, Na+/Ca2+ exchange rate could be of importance for Na+-K+-ATPase mRNA expression (38). It may be that these intracellular differences brought about by the addition of arm exercise are responsible for the reduced β1 expression 5 h after AL exercise compared with L exercise. Nevertheless, none of the possible intracellular differences found between AL and L exercise were of a magnitude that significantly changed the exercise-induced increase in mRNA expression of the other Na+-K+-ATPase subunits.
Even though the active muscle mass seems to be of little importance for changes in Na+-K+-ATPase mRNA expression, differences in training status, exercise intensity, and exercise duration have the potential to affect the increase in Na+-K+-ATPase mRNA after exercise. Previously, our group reported a reduced increase in α1 mRNA after exercise when subjects performed the same exercise after a period of training (33), suggesting that relative workload is of importance for the exercise-induced increase in at least some of the Na+-K+-ATPase subunits. Furthermore, findings of 16, 9, and 39% increases in α1, α2, and β1 protein expression after 6 days of 2-h cycling (15) compared with 37, 22, and 33% after resistance training for 30 min three times per week for 6 wk (9) suggest that either the higher intensity or longer duration of the training period leads to the larger changes in α1 and α2 expression after resistance training compared with cycling. Nevertheless, the importance of exercise duration, intensity, and fitness level for changes in Na+-K+-ATPase mRNA needs further investigation.
This is the first study to describe the relative mRNA expression level of the Na+-K+-ATPase subunits present in human skeletal muscle. Expression of α2 and β1 mRNA was the most abundant, followed by α1, β3, and β2. No reliable detection of α3 and α4 was possible. The current finding of α2 mRNA being most expressed is in agreement with data from rat skeletal muscle (34). It should be noted that expression of the Na+-K+-ATPase α3 and α4 mRNA in the present study corresponded to <1 molecule/μl in the sample subjected to PCR analysis. In the majority of samples, Na+-K+-ATPase α4 expression was undetectable, even though the use of synthetic oligonucleotides corresponding to the expected target sequences showed that any expression would have been detected. Furthermore, α4 expression in commercially obtained RNA from human testes was detected as previously reported (41). A recent study did find expression of α4 mRNA in human skeletal muscle (23). Because the primers used in the present study span exons 2 and 3 of the ATP1A4 gene that was shown to be expressed in muscle (23), no obvious explanation for the controversy exists. Nevertheless, α4 seems to be of little quantitative importance compared with the high level of α2 and β1 mRNA expression. Furthermore, it should be noted that low abundant expression detected in muscle biopsies could stem from other tissues in the biopsy, such as adipose, nerve, vascular, or connective tissue cells.
Although no differences were found between AL and L exercise, except for β1 mRNA expression, significant increases in Na+-K+-ATPase subunit mRNA were observed for α1, α2, β1, and β3 after the high-intensity intermittent exercise protocol. Likewise, an increase in PDK4 expression was apparent (35). GAPDH mRNA tended to increase after exercise, and when the changes observed at 0, 1, 3, and 5 h were averaged, a calculation termed average postexercise response in a previous study of mRNA expression (29), GAPDH mRNA expression was higher (P = 0.005) after exercise. The analysis of the relative amount of Na+-K+-ATPase subunit mRNA in resting human skeletal muscle allows us to conclude that the changes in α2 and β1 mRNA are quantitatively the most important, even though the fold change for α1 was the highest. However, this does not necessarily mean that changes in α2 and β1 mRNA expression are physiologically the most relevant, exemplified by the finding that both α1 and β1 protein expression in rat alveolar epithelial cells can be increased by dexamethasone when only β1 and not α1 mRNA abundance is increased (4). The increase in β1 protein expression has previously been suggested to cause increased α1 stability (46), suggesting posttranslational regulation of expression.
The non-subunit-specific Na+-K+-ATPase expression determined by [3H]ouabain binding is consistently reported to be ∼300 pmol/g wet weight in human skeletal muscle (see Ref. 8), and after various forms of exercise training, the Na+-K+-ATPase content increases around 14–22% (8). In contrast, changes in Na+-K+-ATPase mRNA expression of various subunits were between two- and fivefold in the present and other studies (29, 33) and are less consistent than changes in protein data. Thus a substantially larger change in mRNA expression seems to precede more modest protein adaptations. Furthermore, repeated increases in mRNA levels may be necessary before an increase in protein expression can be expected, because elevated Na+-K+-ATPase-specific mRNA levels after one exercise bout do not result in increased protein expression (29). The finding of an increase in α1 mRNA is in agreement with a previous finding by our group (33), whereas changes in α2 and β1 mRNA were not previously observed (33). When average postexercise response was calculated in the previous study (33), only one subject did not show an increase in α2 mRNA (P = 0.100) and all subjects had an increase in β1 mRNA (P = 0.044), making it likely that an undetected increase did exist. Furthermore, the present finding of an increase in Na+-K+-ATPase subunit α1, α2, β1, and β3 mRNA after AL and L exercise is in agreement with data from a recent study (29). The lack of an exercise-induced increase in β2 mRNA expression in the current study is in contrast to the twofold increase in β2 mRNA average postexercise response previously found (29). In the present study, β2 mRNA average postexercise response was 1.3-fold, and a power analysis revealed a 2-fold increase to be necessary for significant detection. Nevertheless, the low expression level of β2 mRNA found in the present study indicates that changes in β2 mRNA are of little quantitative importance.
In summary, the present study has shown that the engagement of a large compared with a small muscle mass during intense intermittent exercise does not result in a higher exercise-induced increase of muscle Na+-K+-ATPase subunit-specific mRNA. Furthermore, it was demonstrated that of the Na+-K+-ATPase subunits, β1 and α2 mRNA are the most abundantly expressed in resting human skeletal muscle. Thus the typical finding of a two- fivefold increase in mRNA expression of all Na+-K+-ATPase subunits after exercise leads to the conclusion that increases in α2 and β1 mRNA after exercise are the quantitatively most important.
Perspectives
The results from this study suggest that intracellular events are responsible for the exercise-induced upregulation of Na+-K+-ATPase content in human skeletal muscle, although the mechanism remains uncertain. Further research is needed to clarify potential signaling cascades involved in the regulation of Na+-K+-ATPase subunit gene expression in relation to exercise.
GRANTS
This study was supported by grants from Team Danmark and Copenhagen Muscle Research Centre (504-14 Danish National Research Foundation).
FOOTNOTES
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Merete Vannby for skilled technical assistance.
REFERENCES
- 1 Andersen P, Adams RP, Sjogaard G, Thorboe A, and Saltin B. Dynamic knee extension as model for study of isolated exercising muscle in humans. J Appl Physiol 59: 1647–1653, 1985.
Link | ISI | Google Scholar - 2 Andersen P and Saltin B. Maximal perfusion of skeletal muscle in man. J Physiol 366: 233–249, 1985.
Crossref | PubMed | ISI | Google Scholar - 3 Bangsbo J, Madsen K, Kiens B, and Richter EA. Effect of muscle acidity on muscle metabolism and fatigue during intense exercise in man. J Physiol 495: 587–596, 1996.
Crossref | PubMed | ISI | Google Scholar - 4 Barquin N, Ciccolella DE, Ridge KM, and Sznajder JI. Dexamethasone upregulates the Na-K-ATPase in rat alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 273: L825–L830, 1997.
Link | ISI | Google Scholar - 5 Brenner I, Shek PN, Zamecnik J, and Shephard RJ. Stress hormones and the immunological responses to heat and exercise. Int J Sports Med 19: 130–143, 1998.
Crossref | PubMed | ISI | Google Scholar - 6 Bustin SA. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol 29: 23–39, 2002.
Crossref | PubMed | ISI | Google Scholar - 7 Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.
PubMed | ISI | Google Scholar - 8 Clausen T. Na+-K+ pump regulation and skeletal muscle contractility. Physiol Rev 83: 1269–1324, 2003.
Link | ISI | Google Scholar - 9 Dela F, Holten M, and Juel C. Effect of resistance training on Na,K pump and Na+/H+ exchange protein densities in muscle from control and patients with type 2 diabetes. Pflügers Arch 447: 928–933, 2004.
Crossref | PubMed | ISI | Google Scholar - 10 Dorup I and Clausen T. Effects of adrenal steroids on the concentration of Na+-K+ pumps in rat skeletal muscle. J Endocrinol 152: 49–57, 1997.
Crossref | PubMed | ISI | Google Scholar - 11 Dorup I, Flyvbjerg A, Everts ME, and Orskov H. Effects of growth hormone on growth and muscle Na+-K+ pump concentration in K+-deficient rats. Am J Physiol Endocrinol Metab 262: E511–E517, 1992.
Link | Google Scholar - 12 Ewart HS and Klip A. Hormonal regulation of the Na+-K+-ATPase: mechanisms underlying rapid and sustained changes in pump activity. Am J Physiol Cell Physiol 269: C295–C311, 1995.
Link | ISI | Google Scholar - 13 Fisher DA. Physiological variations in thyroid hormones: physiological and pathophysiological considerations. Clin Chem 42: 135–139, 1996.
PubMed | ISI | Google Scholar - 14 Godfrey RJ, Madgwick Z, and Whyte GP. The exercise-induced growth hormone response in athletes. Sports Med 33: 599–613, 2003.
Crossref | PubMed | ISI | Google Scholar - 15 Green HJ, Barr DJ, Fowles JR, Sandiford SD, and Ouyang J. Malleability of human skeletal muscle Na+-K+-ATPase pump with short-term training. J Appl Physiol 97: 143–148, 2004.
Link | ISI | Google Scholar - 16 Hackney AC, Premo MC, and McMurray RG. Influence of aerobic versus anaerobic exercise on the relationship between reproductive hormones in men. J Sports Sci 13: 305–311, 1995.
Crossref | PubMed | ISI | Google Scholar - 17 Hansen O and Clausen T. Quantitative determination of Na+-K+-ATPase and other sarcolemmal components in muscle cells. Am J Physiol Cell Physiol 254: C1–C7, 1988.
PubMed | ISI | Google Scholar - 18 Harmer AR, McKenna MJ, Sutton JR, Snow RJ, Ruell PA, Booth J, Thompson MW, Mackay NA, Stathis CG, Crameri RM, Carey MF, and Eager DM. Skeletal muscle metabolic and ionic adaptations during intense exercise following sprint training in humans. J Appl Physiol 89: 1793–1803, 2000.
Link | ISI | Google Scholar - 19 Hundal HS, Maxwell DL, Ahmed A, Darakhshan F, Mitsumoto Y, and Klip A. Subcellular distribution and immunocytochemical localization of Na,K-ATPase subunit isoforms in human skeletal muscle. Mol Membr Biol 11: 255–262, 1994.
Crossref | PubMed | ISI | Google Scholar - 20 Jewell EA, Shamraj OI, and Lingrel JB. Isoforms of the α subunit of Na,K-ATPase and their significance. Acta Physiol Scand Suppl 607: 161–169, 1992.
PubMed | Google Scholar - 21 Juel C. Skeletal muscle Na+/H+ exchange in rats: pH dependency and the effect of training. Acta Physiol Scand 164: 135–140, 1998.
Crossref | PubMed | Google Scholar - 22 Juel C, Nielsen JJ, and Bangsbo J. Exercise-induced translocation of Na+-K+ pump subunits to the plasma membrane in human skeletal muscle. Am J Physiol Regul Integr Comp Physiol 278: R1107–R1110, 2000.
Link | ISI | Google Scholar - 23 Keryanov S and Gardner KL. Physical mapping and characterization of the human Na,K-ATPase isoform, ATP1A4. Gene 292: 151–166, 2002.
Crossref | PubMed | ISI | Google Scholar - 24 Kindermann W, Schnabel A, Schmitt WM, Biro G, Cassens J, and Weber F. Catecholamines, growth hormone, cortisol, insulin, and sex hormones in anaerobic and aerobic exercise. Eur J Appl Physiol Occup Physiol 49: 389–399, 1982.
Crossref | PubMed | ISI | Google Scholar - 25 Kjeldsen K, Richter EA, Galbo H, Lortie G, and Clausen T. Training increases the concentration of [3H]ouabain-binding sites in rat skeletal muscle. Biochim Biophys Acta 860: 708–712, 1986.
Crossref | PubMed | ISI | Google Scholar - 26 Lavoie L, Levenson R, Martin-Vasallo P, and Klip A. The molar ratios of alpha and beta subunits of the Na+-K+-ATPase differ in distinct subcellular membranes from rat skeletal muscle. Biochemistry 36: 7726–7732, 1997.
Crossref | PubMed | ISI | Google Scholar - 27 Luger A, Deuster PA, Kyle SB, Gallucci WT, Montgomery LC, Gold PW, Loriaux DL, and Chrousos GP. Acute hypothalamic-pituitary-adrenal responses to the stress of treadmill exercise. Physiologic adaptations to physical training. N Engl J Med 316: 1309–1315, 1987.
Crossref | PubMed | ISI | Google Scholar - 28 McKenna MJ. Effects of training on potassium homeostasis during exercise. J Mol Cell Cardiol 27: 941–949, 1995.
Crossref | PubMed | ISI | Google Scholar - 29 Murphy KT, Snow RJ, Petersen AC, Murphy RM, Mollica J, Lee JS, Garnham AP, Aughey RJ, Leppik JA, Medved I, Cameron-Smith D, and McKenna MJ. Intense exercise up-regulates Na+,K+-ATPase isoform mRNA, but not protein expression in human skeletal muscle. J Physiol 556: 507–519, 2004.
Crossref | PubMed | ISI | Google Scholar - 30 Murphy RM, Watt KK, Cameron-Smith D, Gibbons CJ, and Snow RJ. Effects of creatine supplementation on housekeeping genes in human skeletal muscle using real-time RT-PCR. Physiol Genomics 12: 163–174, 2003.
Link | ISI | Google Scholar - 31 Muto S, Nemoto J, Okada K, Miyata Y, Kawakami K, Saito T, and Asano Y. Intracellular Na+ directly modulates Na+,K+-ATPase gene expression in normal rat kidney epithelial cells. Kidney Int 57: 1617–1635, 2000.
Crossref | PubMed | ISI | Google Scholar - 32 Nielsen JJ, Mohr M, Klarskov C, Kristensen M, Krustrup P, Juel C, and Bangsbo J. Effects of high-intensity intermittent training on potassium kinetics and performance in human skeletal muscle. J Physiol 554: 857–870, 2004.
Crossref | PubMed | ISI | Google Scholar - 33 Nordsborg N, Bangsbo J, and Pilegaard H. Effect of high-intensity training on exercise-induced gene expression specific to ion homeostasis and metabolism. J Appl Physiol 95: 1201–1206, 2003.
Link | ISI | Google Scholar - 34 Orlowski J and Lingrel JB. Tissue-specific and developmental regulation of rat Na,K-ATPase catalytic α isoform and β subunit mRNAs. J Biol Chem 263: 10436–10442, 1988.
PubMed | ISI | Google Scholar - 35 Pilegaard H and Neufer PD. Transcriptional regulation of pyruvate dehydrogenase kinase 4 in skeletal muscle during and after exercise. Proc Nutr Soc 63: 221–226, 2004.
Crossref | PubMed | ISI | Google Scholar - 36 Pilegaard H, Ordway GA, Saltin B, and Neufer PD. Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise. Am J Physiol Endocrinol Metab 279: E806–E814, 2000.
Link | ISI | Google Scholar - 37 Psilander N, Damsgaard R, and Pilegaard H. Resistance exercise alters MRF and IGF-I mRNA content in human skeletal muscle. J Appl Physiol 95: 1038–1044, 2003.
Link | ISI | Google Scholar - 38 Rayson BM. [Ca2+]i regulates transcription rate of the Na+/K+-ATPase α1 subunit. J Biol Chem 266: 21335–21338, 1991.
PubMed | ISI | Google Scholar - 39 Rhee MS, Perianayagam A, Chen P, Youn JH, and McDonough AA. Dexamethasone treatment causes resistance to insulin-stimulated cellular potassium uptake in the rat. Am J Physiol Cell Physiol 287: C1229–C1237, 2004.
Link | ISI | Google Scholar - 40 Ruff RL. Effects of temperature on slow and fast inactivation of rat skeletal muscle Na+ channels. Am J Physiol Cell Physiol 277: C937–C947, 1999.
Link | ISI | Google Scholar - 41 Shamraj OI and Lingrel JB. A putative fourth Na+,K+-ATPase α-subunit gene is expressed in testis. Proc Natl Acad Sci USA 91: 12952–12956, 1994.
Crossref | PubMed | ISI | Google Scholar - 42 Sjogaard G. Potassium and fatigue: the pros and cons. Acta Physiol Scand 156: 257–264, 1996.
Crossref | PubMed | Google Scholar - 43 Smallridge RC, Whorton NE, Burman KD, and Ferguson EW. Effects of exercise and physical fitness on the pituitary-thyroid axis and on prolactin secretion in male runners. Metabolism 34: 949–954, 1985.
Crossref | PubMed | ISI | Google Scholar - 44 Suwannachot P, Verkleij CB, Kocsis S, van Weeren PR, and Evertst ME. Specificity and reversibility of the training effects on the concentration of Na+,K+-ATPase in foal skeletal muscle. Equine Vet J 33: 250–255, 2001.
PubMed | ISI | Google Scholar - 45 Therien AG and Blostein R. Mechanisms of sodium pump regulation. Am J Physiol Cell Physiol 279: C541–C566, 2000.
Link | ISI | Google Scholar - 46 Thompson CB, Dorup I, Ahn J, Leong PK, and McDonough AA. Glucocorticoids increase sodium pump α2- and β1-subunit abundance and mRNA in rat skeletal muscle. Am J Physiol Cell Physiol 280: C509–C516, 2001.
Link | ISI | Google Scholar - 47 Tremblay MS, Copeland JL, and Van Helder W. Effect of training status and exercise mode on endogenous steroid hormones in men. J Appl Physiol 96: 531–539, 2004.
Link | ISI | Google Scholar - 48 Vanhelder WP, Goode RC, and Radomski MW. Effect of anaerobic and aerobic exercise of equal duration and work expenditure on plasma growth hormone levels. Eur J Appl Physiol Occup Physiol 52: 255–257, 1984.
Crossref | PubMed | ISI | Google Scholar
