ENVIRONMENTAL, EXERCISE AND RESPIRATORY PHYSIOLOGY

Ionic mechanisms of excitation-induced regulation of Na+-K+-ATPase mRNA expression in isolated rat EDL muscle

Published Online:https://doi.org/10.1152/ajpregu.00707.2005

Abstract

This study investigated the effects of electrical stimulation on Na+-K+-ATPase isoform mRNA, with the aim to identify factors modulating Na+-K+-ATPase mRNA in isolated rat extensor digitorum longus (EDL) muscle. Interventions designed to mimic exercise-induced increases in intracellular Na+ and Ca2+ contents and membrane depolarization were examined. Muscles were mounted on force transducers and stimulated with 60-Hz 10-s pulse trains producing tetanic contractions three times at 10-min intervals. Ouabain (1.0 mM, 120 min), veratridine (0.1 mM, 30 min), and monensin (0.1 mM, 30 min) were used to increase intracellular Na+ content. High extracellular K+ (13 mM, 60 min) and the Ca2+ ionophore A-23187 (0.02 mM, 30 min) were used to induce membrane depolarization and elevated intracellular Ca2+ content, respectively. Muscles were analyzed for Na+-K+-ATPase α1–α3 and β1–β3 mRNA (real-time RT-PCR). Electrical stimulation had no immediate effect on Na+-K+-ATPase mRNA; however at 3 h after stimulation, it increased α1, α2, and α3 mRNA by 223, 621, and 892%, respectively (P = 0.010), without changing β mRNA. Ouabain, veratridine, and monensin increased intracellular Na+ content by 769, 724, and 598%, respectively (P = 0.001) but did not increase mRNA of any isoform. High intracellular K+ concentration elevated α1 mRNA by 160% (P = 0.021), whereas A-23187 elevated α3 mRNA by 123% (P = 0.035) but reduced β1 mRNA by 76% (P = 0.001). In conclusion, electrical stimulation induced subunit-specific increases in Na+-K+-ATPase mRNA in isolated rat EDL muscle. Furthermore, Na+-K+-ATPase mRNA appears to be regulated by different stimuli, including cellular changes associated with membrane depolarization and increased intracellular Ca2+ content but not increased intracellular Na+ content.

in skeletal muscle, Na+-K+-ATPase activity maintains the transmembrane Na+ and K+ concentration gradients necessary for repeated action potential generation. The Na+-K+-ATPase comprises a catalytic α-subunit and a glycosylated β-subunit, with different genes encoding for four α-isoforms (α1–α4) and three β-isoforms (β1–β3). Human skeletal muscle has recently been shown to express mRNA for each of the α1- to α3- and β1- to β3-isoforms (24, 29) and also for the α4-isoform (29). Rat skeletal muscle has also been reported to express mRNA for each of the α1- to α3- and β1- and β2-isoforms (31, 43), whereas the mRNA for the α4- and β3-isoforms do not appear to have been probed.

Only ∼6 min of intense exercise elevated the mRNA expression of the α1- to α3- and β1- to β3-isoforms in human muscle (24), whereas more prolonged exercise elevated the mRNA expression of the α1-, α3-, and β2-isoforms in human muscle (23) and the mRNA expression of the α1- and β2-isoforms in rat muscle (43). Whether electrical stimulation exerts similar effects is unknown and was therefore investigated here. It was hypothesized that three bouts of high-frequency electrical stimulation of isolated rat extensor digitorum longus (EDL) muscle would increase the mRNA expression of one or several of the Na+-K+-ATPase α1- to α3- and β1- to β3-isoforms.

The intracellular signals involved in the regulation in the mRNA expression of the Na+-K+-ATPase isoforms in skeletal muscle have not been identified. Because acute exercise increases the mRNA expression of the Na+-K+-ATPase isoforms in mammalian muscle (24, 43), it is likely that one or several of the transmembrane ionic fluxes and subsequent intracellular ionic concentration changes, which occur with exercise, may be involved in the signaling pathways inducing mRNA expression of the Na+-K+-ATPase isoforms.

Repeated muscle contractions induce an elevation in intracellular Na+ content in human (40) and rat muscle (20). However, because this increases Na+-K+-ATPase activity (26), this elevation in intracellular Na+ content is transient. It is possible that this transient rise in intracellular Na+ content is involved in increasing the mRNA expression of the Na+-K+-ATPase isoforms in skeletal muscle. In rat kidney cells, increasing the intracellular Na+ content and/or Na+ influx with ouabain, an inhibitor of Na+-K+-ATPase, induced an ∼100% increase in the mRNA expression of both the α1- and β1-isoforms (36). Furthermore, in chicken skeletal muscle cells, veratridine, an activator of the voltage-gated Na+-channels, induced a 70 and 150% increase in the mRNA expression of the α- and β-subunit isoforms, respectively (42). Monensin, a specific Na+ ionophore, has also been used to elevate the intracellular Na+-to-K+ ratio in rat skeletal muscle (8), but the effects of monensin on the mRNA expression of the Na+-K+-ATPase isoforms are unknown. Interestingly, in rat hindlimb muscle, an increase in intracellular Na+ content induced by dietary K+ deficiency reduced the mRNA expression of the α2-isoform by 35%, with no significant effect on the mRNA expression of either of the α1- or β1-isoforms (1). Despite the above-mentioned exception, it was therefore hypothesized that elevated intracellular Na+ content and/or Na+ influx, induced by either ouabain, veratridine, or monensin, would increase the mRNA expression of one or several of the Na+-K+-ATPase α1- to α3- and β1- to β3-isoforms in rat skeletal muscle.

Repeated muscle contractions induce a reduction in intracellular K+ concentration and a subsequent increase in muscle extracellular K+ concentration ([K+]o), leading to membrane depolarization (38). During intense exercise in humans, muscle [K+]o can reach as high as ∼13 mM (41). In isolated rat EDL muscle, a [K+]o of 13 mM induced a membrane depolarization of 26 mV (13). No study has elevated muscle [K+]o to investigate the mRNA expression of the Na+-K+-ATPase isoforms. However, in rat liver cells, low [K+]o (0.25–0.65 mM) induced a 250% increase in the mRNA expression of the α-subunit isoform (35); in canine kidney cells, low [K+]o induced a 200% increase in the mRNA expression of both the α- and β-subunit isoforms (3). Such low [K+]o would lead to membrane depolarization (10). It was therefore hypothesized that membrane depolarization induced by high [K+]o, to replicate repeated muscle contractions, would increase the mRNA expression of one or several of the Na+-K+-ATPase α1- to α3- and β1- to β3-isoforms in rat skeletal muscle.

Baseline cytosolic Ca2+ concentration increases during repeated muscle contractions in isolated mammalian muscle (44). In rat kidney cells, elevating the intracellular Ca2+ concentration from 0.1 to 4.0 μM induced a 300% increase in the mRNA expression of both the α1- and β1-isoforms (37). Whether increased intracellular Ca2+ content exerts similar effects on the mRNA expression of the other Na+-K+-ATPase isoforms is unknown. The Ca2+ ionophore A-23187 has been shown to elevate both muscle Ca2+ content and 45Ca uptake in rat EDL muscle (11), as well as the intracellular free Ca2+ content in cultured myotubes (16). On the basis of the findings by Rayson (37), it was hypothesized that elevated intracellular Ca2+ content and/or Ca2+ influx would increase the mRNA expression of one or several of the Na+-K+-ATPase α1- to α3- and β1- to β3-isoforms in rat skeletal muscle.

The effects of electrical stimulation on the mRNA expression of the Na+-K+-ATPase isoforms was studied here, with the aim to also identify the ionic factors modulating this expression in isolated rat EDL muscle. We show that electrical stimulation increased the mRNA expression of the Na+-K+-ATPase α-isoforms but not of the β-isoforms in isolated rat EDL muscle. Furthermore, the mRNA expression of the Na+-K+-ATPase isoforms appears to involve the cellular changes associated with membrane depolarization and increased intracellular Ca2+ content and/or Ca2+ influx but not of increased intracellular Na+ content.

METHODS

Animals and preparation of muscles.

Experiments were carried out with 4-wk-old female and male Wistar rats weighing ∼60–70 g. Rats of this age were used because the relatively small size of their EDL muscles (∼25 mg) minimizes the diffusional barriers to substrates, ions, and oxygen to the cell surface. The animals were fed ad libitum and were maintained in a temperature-controlled environment (21°C) with constant day length (12 h). The animals were killed by cervical dislocation, followed by decapitation, with intact EDL muscles, a predominantly fast-twitch fiber muscle (2), dissected out as previously described (27). All handling and use of animals complied with Danish animal welfare regulations.

Muscles were equilibrated for 30 min at 30°C in standard Krebs-Ringer bicarbonate buffer (KR) (pH 7.4) containing the following (in mM): 122.1 NaCl, 25.1 NaHCO3, 2.8 KCl, 1.2 KH2PO4, 1.2 MgSO4, 1.3 CaCl2, and 5.0 d-glucose; this was bubbled continuously with a mixture of 95% O2-5% CO2. In buffer with 13.0 mM [K+]o, an equivalent amount of Na+ was omitted to maintain isosmolarity.

Effect of electrical stimulation on intracellular Na+ and K+ contents.

Intact muscles were mounted at resting length on electrodes for isometric contractions and equilibrated for 30 min in KR at 30°C. Muscles were then either rested or exposed to field stimulation across the central region through platinum electrodes, using either one, two, or three stimulation bouts, each comprising 10 s of continuous 60-Hz stimulation (0.2 ms, 12 V), given at 10-min intervals. We measured force (mN) using force displacement transducers, which were recorded with a chart recorder and/or digitally on a computer. Muscles exposed to two stimulation bouts were allowed to rest for 10 min after the second stimulation bout to represent the intracellular Na+ and K+ contents immediately before the third stimulation bout. Muscles were then washed for 4 × 15 min in ice-cold Na+-free Tris sucrose buffer (pH 7.45, containing the following in mM: 263.5 sucrose, 4.7 KCl, 1.2 KH2PO4, 1.2 MgSO4, 1.3 CaCl2) to remove all extracellular Na+ (8). Muscles were blotted, tendons were removed, muscle wet weight was determined, and the muscles were soaked overnight in 0.3 M trichloroacetic acid (TCA) to give complete extraction of ions from the tissue (5). The Na+ content in the TCA extract was measured by flame photometry (FLM3; Radiometer, Copenhagen, Denmark) with lithium as internal standard. Values for Na+ content were then multiplied by 1.59 to correct for the loss of intracellular Na+ during the ice-cold washout (see Fig. 1, as described below). In contrast, the loss of K+ during the washout was minimal (8).

Fig. 1.

Fig. 1.Time course of muscle Na+ content during washout in ice-cold Na+-free Tris-sucrose buffer in rat extensor digitorum longus (EDL) muscle. Muscles were mounted for isometric contractions and equilibrated for 30 min at 30°C in standard Krebs-Ringer (KR). Muscles were then transferred to ice-cold Na+-free Tris-sucrose buffer for washout for durations ranging from 30 to 180 min. Every 15 min during washout, muscles were transferred to new tubes and were kept agitated by continuous bubbling with air. After washout, muscles were blotted, and tendons were removed, weighed, and taken for flame photometric analysis of Na+ contents. Data are means and SD; n = 4; r2 of regression line > 0.99. The correction factor for intracellular Na+ content was obtained by dividing the intercept value of the regression line (time = 0) with the regression line value at 60 min of washout (correction factor = 1.59). Na+ content of the muscles at the end of the 60-min washout was corrected for the loss of intracellular Na+ by multiplying with this factor. Note that the muscle Na+ contents are presented on a log scale.


Effect of washout in ice-cold Na+-free Tris-sucrose buffer on intracellular Na+ content.

Control experiments were performed to determine the loss of intracellular Na+ during the 4 × 15 min (60 min) washout in ice-cold Na+-free Tris sucrose buffer in the EDL muscle, as this has previously only been determined in the soleus muscle (8). Intact muscles were mounted at resting length on electrodes for isometric contractions and equilibrated for 30 min in KR, after which muscles were transferred to ice-cold Na+-free Tris-sucrose buffer for washout for 30, 60, 90, 120, 150, or 180 min. Every 15 min during washout, muscles were transferred to new tubes and were kept agitated by continuous bubbling with air. After washout, muscles were blotted, tendons were cut off, muscle wet weight was determined, and the muscles were soaked overnight in 0.3 M TCA. The Na+ content in the TCA extract was measured by flame photometry, as described above. Figure 1 demonstrates that, after an initial 30 min of washout, which allows for removal of extracellular Na+ from the tissue, the muscle Na+ content showed an exponential decline with washout duration. This relationship can be tightly fitted by a linear regression line in the semi-logarithmic plot (r2 > 0.99) and is assumed to represent the washout of intracellular Na+ (33). To determine the intracellular Na+ content of the muscles at time 0 (t = 0; prewashout), the regression line was used to calculate a correction factor. The correction factor was calculated by dividing the intercept value of the regression line (t = 0) with the regression line value at 60 min of washout. From this, all values for intracellular Na+ contents determined after a 60-min (4 × 15 min) washout were corrected by multiplying by a factor of 1.59.

Effects of electrical stimulation on the mRNA expression of the Na+-K+-ATPase isoforms.

Muscles were mounted for isometric contractions in thermostated chambers containing standard KR and were adjusted to optimal length for force production. After a standard equilibration of 30 min in KR, muscles were either rested or exposed to three stimulation bouts, each comprising 10 s of continuous 60-Hz stimulation (0.2 ms, 12 V) given at 10-min intervals. After the final stimulation bout, muscles were either immediately removed or allowed to recover for a further 3 h, because previous studies (24, 34) have demonstrated increased mRNA expression in the 2- to 4-h period after exercise. After removal, muscles were blotted, tendons were removed, and muscles were immediately frozen in liquid N2 for analyses of the mRNA expression of the Na+-K+-ATPase isoforms.

Effects of muscle stretching on the mRNA expression of the Na+-K+-ATPase isoforms.

Control experiments were performed to show that any increase in mRNA expression of the Na+-K+-ATPase isoforms with electrical stimulation was not due to an artifact of the experimental design, specifically from stretching of muscles to optimal force-generating length. No difference was found between control muscles and those stretched passively for 30 min to produce a force of 10 or 50 mN, which is within the range required to reach optimal force-generating length, for the mRNA expression of any isoform (unpublished observations).

Effects of ouabain, veratridine, and monensin on intracellular Na+ content.

Muscles were placed in polyethylene baskets; after a standard equilibration of 30 min in standard KR, muscles were incubated for either 120 min with ouabain (1.0 mM), for 30 min with veratridine (0.1 mM), or for 30 min with monensin (0.1 mM). Muscles were then allowed to recover for a further 3 h in standard KR, before being washed for 4 × 15 min in ice-cold Na+-free Tris-sucrose buffer to remove all extracellular Na+. Muscles were then blotted, tendons were removed, and muscle wet weight was determined. Muscles were soaked overnight in 0.3 M TCA, and the Na+ content in the TCA extract was measured by flame photometry, as described above. Values were then multiplied by 1.59 to correct for the loss of intracellular Na+ during the ice-cold washout.

Effects of interventions utilized to induce increased intracellular Na+ and Ca2+ contents and of membrane depolarization on the mRNA expression of the Na+-K+-ATPase isoforms.

For each of the following interventions, muscles were placed in polyethylene baskets and, after equilibration for 30 min in standard KR, were incubated in the appropriate buffer for the indicated duration. All muscles were then allowed to recover for a further 3 h in standard KR (4 mM K+), after which they were blotted, tendons were removed, and the muscle was frozen in liquid N2 for measurement of the mRNA expression of the Na+-K+-ATPase isoforms. Control muscles were incubated for durations matching their respective experimental muscles in standard KR.

Increased intracellular Na+ content and/or Na+ influx induced by ouabain, veratridine, and monensin.

Matching groups of muscles were used to determine the mRNA expression of the Na+-K+-ATPase isoforms after ouabain (120 min, 1.0 mM), veratridine (30 min, 0.1 mM), or monensin (30 min, 0.1 mM) exposure and compared to those used to determine the changes in intracellular Na+ content arising from these interventions.

Membrane depolarization induced by high [K+]o.

Membrane depolarization was induced by incubating muscles for 60 min in KR containing 13 mM [K+]o (13).

Increased intracellular Ca2+ content and/or Ca2+ influx induced by A-23187.

Increased intracellular Ca2+ content and/or Ca2+ influx was induced by incubating muscles for 30 min in KR containing the Ca2+ ionophore A-23187 (0.02 mM) (11, 16).

Measurement of the mRNA expression of the Na+-K+-ATPase isoforms.

Total RNA was extracted from ∼10 mg of muscle using the FastRNA reagents (BIO 101, Vista, CA), with methods previously described (25). The resulting RNA pellet was dissolved in EDTA-treated water, and total RNA concentration was determined spectrophotometrically at 260 nm. The ratio of absorbance at 260 and 280 nm (260/280) was 1.95 (SD 0.33), and the concentration of yielded RNA was not significantly different between control and test muscles (P = 0.152). RNA (1 μg) was transcribed into cDNA using the Promega AMV reverse transcription kit (Promega, Madison, WI), with oligo(dT) primers, with the resulting cDNA stored at −20°C for further analysis.

Real-time PCR (GeneAmp 5700 sequence detection system) was run for 1 cycle (50°C for 2 min, 95°C for 10 min) and 40 cycles (95°C for 15 s, 60°C for 60 s). Primer sequences were designed for the rat Na+-K+-ATPase α1–α4 and β1–β3 genes from published sequences (Table 1). However, mRNA expression of the Na+-K+-ATPase α4-isoform could not be detected in all muscle samples by RT-PCR. The sizes of the PCR fragments amplified with each primer (126–268 bp) are included in Table 1 and are within the size range for close to 100% PCR efficiency, thereby validating this method. All samples were run in triplicate, and measurements included a no-template control (no cDNA), as well as a rat skeletal muscle sample endogenous control. Primer sequences for the commonly used housekeeping gene cyclophilin (Cyc) (24, 25) were also designed from published sequences (Table 1), and Cyc mRNA was used as a control to account for any variations in the amount of input RNA and the efficiency of reverse transcription. The mRNA expression of Cyc was not significantly altered with any intervention (electrical stimulation, P = 0.690; ouabain, veratridine, and monensin, P = 0.976; 13 mM [K+]o, P = 0.133; A-23187, P = 0.761), when expressed in the logarithmic form of 2−CT and using the statistical analyses described below. Gene expression was quantified from fluorescence emission using a cycle threshold (CT) method, whereby the relative expression of the genes compared with control sample was made with the expression, 2−ΔΔCT, in which the expression of each gene was normalized for input cDNA with the housekeeping gene Cyc. As an estimate of the relative basal mRNA expression of the Na+-K+-ATPase isoforms, a ΔCT value was calculated by subtracting the basal CYC CT from the basal isoform CT, with the relative basal isoform mRNA expression then calculated with the expression 2−ΔCT. The order of relative basal mRNA expression of the Na+-K+-ATPase isoforms was (highest to lowest) β1 > α2 > β2 > β3 > α3 > α1. This order compares roughly to that found in human vastus lateralis muscle (β1 > α2 > α1 > β3 > β2 > α3) (29), with the main difference being that the mRNA expression of the α1-isoform in that study was higher than that of the β3- and α3-isoforms. This contrast may reflect species differences or variations in fiber-type composition between the predominantly fast-twitch EDL muscle and the vastus lateralis muscle of mixed fiber-type composition (7), because, in the predominantly slow-twitch soleus muscle, we have also estimated the relative basal mRNA expression of the α1-isoform to be higher than that of the β3- and α3-isoforms (Murphy, Macdonald, McKenna, and Clausen, unpublished observations). The intra-assay coefficient of variation for each target gene was <13.0% for 2−CT (Table 2), which is within those previously reported (25).

Table 1. Rat Na+-K+-ATPase genes α1–α4 and β1–β3, and Cyc primer sequences used for mRNA analyses

GeneGenBank Accession No.Sense Primer (5′-3′)Antisense Primer (5′-3′)Amplicon Size, bp
α1 NM_012504CAGTGTTTCAGGCTAACCAAGAAACGCCGACTCGGAAGCAT174
α2 NM_012505GCTAGGAGCAGCATAGTTAGTTTCAAAATTAGCCTATGCACTTCCTGATTC171
α3 M90659GGGAGTCTGTGAGGTGGTGTGCTCAAAAACCAGCAGAAGG127
α4 NM_022848TTTTGCTCCAGTTTCCTGCTGGCACTTGCTAACAGCATCA268
β1 NM_013113TCCAAACGTCCTACCTGTCCCGGATTTCAGTGTCCAAGGT204
β2 D90048AGGAGCCAGTGGAACTGAGACCCCCTTAGAAGCTCAAACC229
β3 XM_213132AATCGAGTTCGTCCCTGATGTTCCATCAATTTGGCACTCA230
Cyc M19533CTGATGGCGAGCCCTTGTCTGCTGTCTTTGGAACTTTGTC126

Primer sequences were designed with the use of Primer Express software (Applied Biosystems) from gene sequences obtained from GenBank. Primer specificity was determined by use of a BLAST search. Cyc, cyclophilin.

Table 2. Intra-assay variability of 2−CT values

Gene2−CT CV
α111.2
α211.0
α39.8
β112.2
β211.6
β311.1
Cyc10.0

Values are percent. Each sample was run in triplicate wells in the same real-time PCR run; n = 241. CV, coefficient of variation; CT, cycle threshold.

Chemicals.

All chemicals were of analytical grade. Monensin, veratridine, ouabain, A-23187, and d-glucose were purchased from Sigma (St. Louis, MO).

Statistical analysis.

All data are presented as means (SD). Statistical differences between two groups in the relative mRNA expression were analyzed with an independent-sample Student's t-test. The statistical difference in the relative mRNA expression or intracellular Na+ and K+ contents between three or more groups of muscles was analyzed by using a one-way ANOVA. Differences were located with a Student-Newman-Keuls post hoc test. Significance was accepted at P < 0.05. Power analyses were performed with Power and Precision software (Biostat).

RESULTS

Effect of electrical stimulation on intracellular Na+ and K+ contents and on the mRNA expression of the Na+-K+-ATPase isoforms.

A representative trace of the force responses to the electrical stimulation paradigm is shown in Fig. 2. During the three stimulation bouts, each at 10 s of stimulation at 60 Hz, force decreased by 27.0% (SD 8.1), 17.3% (SD 7.0), and 15.1% (SD 9.4), respectively (n = 6). At 3 h after the final 10-s stimulation bout, peak tetanic force was 49.2% (SD 7.8) of initial peak tetanic force (n = 6).

Fig. 2.

Fig. 2.Representative trace of the force responses to the electrical stimulation paradigm. Muscles were mounted for isometric contractions and equilibrated for 30 min in standard KR. Muscles were then stimulated for 0.5 s at 60 Hz and allowed to rest for 30 min before being stimulated for 10 s at 60 Hz, at 10-min intervals, for 3 stimulation bouts. After the third stimulation bout, muscles were allowed to recover for a further 180 min and were then stimulated for 0.5 s at 60 Hz.


The first 10-s stimulation bout immediately increased intracellular Na+ content by 32.2% (P = 0.003) and reduced intracellular K+ content by 7.9% (P = 0.049; Fig. 3). Intracellular Na+ content was 28.9% (P = 0.016) lower in muscles exposed to two stimulation bouts followed by a 10-min recovery than in resting muscles (Fig. 3). The third 10-s stimulation bout, given at 20 min after the first 10-s stimulation bout, increased intracellular Na+ content by 50.7% (P = 0.001) and reduced intracellular K+ content by 4.4% (P = 0.030), compared with before the third stimulation bout (Fig. 3).

Fig. 3.

Fig. 3.Effects of 3 bouts of high-frequency electrical stimulation (stim) on intracellular Na+ (A) and K+ contents (B) in rat EDL muscle. Muscles were mounted for isometric contractions, equilibrated for 30 min in standard KR, and either allowed to rest for 10 s or stimulated for 10 s at 60 Hz, at 10-min intervals, for either 1 (1 × 10 s), 2 (2 × 10 s), or 3 stimulation bouts (3 × 10 s). Muscles stimulated for 2 stimulation bouts were then allowed to rest for a further 10 min to represent the intracellular Na+ and K+ contents immediately before the third stimulation bout. All muscles were then washed for 4 × 15 min in ice-cold Na+-free Tris-sucrose buffer and blotted; tendons were then removed, weighed, and taken for flame photometric analysis of Na+ and K+ contents. Values for Na+ content were multiplied by 1.59 to correct for the loss of intracellular Na+ during the washout. Bars denote 10-s stimulation bouts. Data are means (•) and SD; n = 4–10. *P < 0.05 vs. rest, †P < 0.05 vs. 1 × 10 s, ‡P < 0.05 vs. 2 × 10 s plus 10-min recovery.


Immediately after the third stimulation bout, there was no significant increase in the mRNA expression of any of the α1-, α2-, or α3-isoforms (Fig. 4). At 3 h after stimulation, these were, however, increased by 223% (P = 0.011), 621% (P = 0.001), and 892% (P = 0.001), respectively (Fig. 4). The mRNA expression of the α2- and α3-isoforms at 3 h poststimulation was also higher than that immediately after electrical stimulation, by 132% (P = 0.020) and 161% (P = 0.004), respectively, whereas there was no significant difference in the mRNA expression of the α1-isoform between these two time points (P = 0.231; Fig. 4). However, electrical stimulation had no significant effect on the mRNA expression of any of the β1- to β3-isoforms, either immediately or at 3 h after stimulation (Fig. 4).

Fig. 4.

Fig. 4.Effects of 3 bouts of high-frequency electrical stimulation and subsequent 3-h recovery on mRNA expression of the Na+-K+-ATPase α1- to α3- and β1- to β3-isoforms in rat EDL muscle. Isoform mRNA expression is expressed relative to control (Con) (1.0). Muscles were mounted for isometric contractions, equilibrated for 30 min in standard KR, and stimulated electrically for 10 s at 60 Hz at 10-min intervals. Muscles were then either immediately removed (Stim) or allowed to recover in standard KR for a further 3 h (Stim+3h). Data are means and SD; n = 8 except Stim where n = 6. *P < 0.02, greater than Con; †P < 0.02, greater than Stim.


Effects of ouabain, veratridine, and monensin on intracellular Na+ content and on the mRNA expression of the Na+-K+-ATPase isoforms.

Ouabain, veratridine, and monensin elevated intracellular Na+ content by 769% (P = 0.001), 724% (P = 0.001), and 598% (P = 0.001), respectively (Fig. 5), as measured after the cessation of exposure to these agents, the 3-h recovery in standard KR, and the ice-cold 4 × 15 min washout.

Fig. 5.

Fig. 5.Effects of ouabain, veratridine, and monensin on intracellular Na+ content in rat EDL muscle. Muscles were placed in polyethylene baskets, equilibrated for 30 min in standard KR, and then incubated without (solid bars) or with ouabain (120 min, 1.0 mM), veratridine (30 min, 0.1 mM), or monensin (30 min, 0.1 mM). They were then allowed to recover in standard KR for a further 3 h (hatched bars). Muscles were then washed for 4 × 15 min in ice-cold Na+-free Tris-sucrose buffer and blotted; tendons were then removed, weighed, and taken for flame photometric analysis of Na+ content. Values for Na+ content were multiplied by 1.59 to correct for the loss of intracellular Na+ during the washout. Data are means and SD; n = 13 for Con, n = 4–7 for ouabain, and n = 4–6 for veratridine and monensin. *P = 0.001, greater than Con.


Ouabain exposure followed by a 3-h recovery had no significant effect on the mRNA expression of any of the α1-, α2-, α3-, or β1-isoforms but reduced the mRNA expression of the β2- and β3-isoforms, by 76% (P = 0.044) and 92% (P = 0.009), respectively (Fig. 6). Neither veratridine nor monensin exposure, followed by a 3-h recovery, had any significant effect on the mRNA expression of any of the α1-, α3-, β1-, or β2-isoforms, but both reduced the mRNA expression of the β3-isoform, by 87% (P = 0.013) and 90% (P = 0.011), respectively, whereas veratridine also reduced the mRNA expression of the α2-isoform by 69% (P = 0.001; Fig. 6).

Fig. 6.

Fig. 6.Effects of ouabain, veratridine, and monensin on mRNA expression of the Na+-K+-ATPase α1- to α3- and β1- to β3-isoforms in rat EDL muscle. Isoform mRNA expression is expressed relative to control (1.0). Muscles were placed in polyethylene baskets, equilibrated for 30 min in standard KR, and then incubated with ouabain (120 min, 1 mM), veratridine (30 min, 0.1 mM), or monensin (30 min, 0.1 mM). They were then allowed to recover in standard KR for a further 3 h. Data are means and SD; n = 6. *P < 0.05, lower than Con.


Effect of 13 mM [K+]o on the mRNA expression of the Na+-K+-ATPase isoforms.

Exposure to 13 mM [K+]o followed by a 3-h recovery increased the mRNA expression of the α1-isoform by 160% (P = 0.021) and tended to increase the mRNA expression of the β3-isoform (P = 0.055; Fig. 7). There was no significant effect of 13 mM [K+]o on the mRNA expression of any of the Na+-K+-ATPase α2-, α3-, β1-, or β2-isoforms (Fig. 7).

Fig. 7.

Fig. 7.Effects of 13 mM extracellular K+ concentration ([K+]o) on mRNA expression of the Na+-K+-ATPase α1- to α3- and β1- to β3-isoforms in rat EDL muscle. Isoform mRNA expression is expressed relative to control (1). Muscles were placed in polyethylene baskets, equilibrated for 30 min in standard KR, and then incubated for 60 min at 13 mM [K+]o, before being allowed to recover in normal KR (4 mM K+) for a further 3 h. Data are means and SD; n = 12. *P < 0.03, greater than Con; #P < 0.06, greater than Con.


Effect of A-23187 on the mRNA expression of the Na+-K+-ATPase isoforms.

A-23187 exposure followed by a 3-h recovery increased the mRNA expression of the α3-isoform by 123% (P = 0.035) and, in contrast, reduced the mRNA expression of the β1-isoform by 76% (P = 0.001; Fig. 8). There was no significant effect of A-23187 on the mRNA expression of any of the α1-, α2-, β2-, or β3-isoforms (Fig. 8).

Fig. 8.

Fig. 8.Effects of A-23187 on mRNA expression of the Na+-K+-ATPase α1- to α3- and β1- to β3-isoforms in rat EDL muscle. Isoform mRNA expression is expressed relative to control (1). Muscles were placed in polyethylene baskets, equilibrated for 30 min in standard KR, and then incubated with A-23187 (30 min, 0.02 mM), before being allowed to recover in normal KR for a further 3 h. Data are means and SD; n = 6. *P < 0.04 vs. Con.


DISCUSSION

This study investigated the effects of high-frequency electrical stimulation on the mRNA expression of the Na+-K+-ATPase isoforms in isolated rat EDL muscle. Factors modulating this expression were also explored, using interventions designed to induce either increased intracellular Na+ or Ca2+ content or membrane depolarization. The first main finding was that three bouts of high-frequency electrical stimulation followed by 3 h of recovery induced subunit-specific Na+-K+-ATPase mRNA expression, with the mRNA expression of each of the catalytic α1-, α2-, and α3-isoforms increased with stimulation. The second main finding was that ouabain, veratridine, and monensin each markedly increased intracellular Na+ content but, surprisingly, did not increase the mRNA expression of any isoform. In fact, each of these interventions reduced the mRNA expression of the β3-isoform and ouabain and veratridine also reduced the mRNA expression of the β2- and α2-isoforms, respectively. In contrast, 13 mM [K+]o, which induces a 26-mV membrane depolarization (13), increased the mRNA expression of the α1-isoform, whereas A-23187, which elevates intracellular Ca2+ content (17) and Ca2+ influx (11), increased the mRNA expression of the α3-isoform but reduced the mRNA expression of the β1-isoform. Thus the mRNA expression of the six Na+-K+-ATPase isoforms expressed in isolated rat EDL muscle appears to be regulated by different intracellular stimuli.

Three bouts of high-frequency electrical stimulation specifically increased the mRNA expression of the α-isoforms.

The effects of three bouts of high-frequency electrical stimulation on the mRNA expression of the Na+-K+-ATPase isoforms clearly differs between the α- and β-subunits. These findings are in contrast to the previously reported increase in the mRNA expression of the β2-isoform but not of the α1-isoform in fast-twitch muscles after 1 h of treadmill running in rats (43). Furthermore, in human vastus lateralis muscle, ∼6 min of intense exercise elevated the mRNA expression of all six Na+-K+-ATPase isoforms (24) whereas ∼55 min of submaximal exercise elevated the mRNA expression of the α1-, α3-, and β2-isoforms (23). Thus the changes in the mRNA expression of the Na+-K+-ATPase isoforms induced with whole body exercise are not necessarily matched with those induced with in vitro electrical stimulation in isolated rat skeletal muscle. This difference may suggest that the mRNA expression of the Na+-K+-ATPase isoforms in skeletal muscle may involve both systemic (e.g., hormonal) and local factors. However, a recent study in humans demonstrated that, despite the concentrations of epinephrine and norepinephrine being significantly higher after exercise involving both arms and legs compared with that involving only legs, there was no difference in the mRNA expression of any of the α1-, α2-, β1-, β2-, and β3-isoforms between the two exercise regimens (29). Thus it appears likely that local factors rather than systemic effects are involved in the mRNA expression of the Na+-K+-ATPase isoforms in skeletal muscle.

The upregulatory effect of electrical stimulation on the mRNA expression of the α-isoforms was not evident until 3 h after stimulation. This is consistent with the higher mRNA expression of genes regulating energy metabolism in the 2- to 4-h period after exercise (34), indicating that the mechanisms involved in increasing mRNA expression (i.e., accelerated transcription, attenuated mRNA degradation, or a combination of both) require several hours to induce a detectable increase in mRNA expression of the Na+-K+-ATPase isoforms. Despite an apparent increase, the lack of significant change in the mRNA expression of any of the α1-, α2-, and α3-isoforms immediately after the final stimulation bout may reflect a type II error (14); however, the statistical power values of 0.72, 0.67, and 0.75, respectively, suggest that this is unlikely. Importantly, we also found that the elevations in mRNA expression of the α-isoforms with electrical stimulation were not due to an artifact of the experimental design, specifically due to the stretching of muscles to optimal force-generating length.

A significant increase in the mRNA expression of the α-isoforms, but not of the β-isoforms, with three bouts of 10 s of electrical stimulation at 60 Hz was also observed in an experiment involving 90 s of 60-Hz electrical stimulation followed by 3 h of recovery in isolated rat EDL muscle (Murphy et al., unpublished observation). Thus α-subunit-specific Na+-K+-ATPase mRNA expression may be an obligatory response to high-frequency electrical stimulation in isolated rat EDL muscle. This response may reflect the overabundance (5.5-fold for mRNA; 1.4- to 3.3-fold for protein) of the β-subunit in mammalian skeletal muscle (18, 29). Thus only an increased expression of the α-subunit may be required for the formation of additional αβ-heterodimers. This response may also reflect the catalytic nature of the α-isoforms, predisposing these isoforms to tight regulation imposed by changes associated with altered ion fluxes. As previously discussed, such changes were thought to include elevations in intracellular Na+ content (36, 42) and intracellular Ca2+ concentration (37) and also membrane depolarization (3, 35). Indeed, as evidenced with the first and third stimulation bouts, the electrical stimulation protocol used in the present study significantly elevated intracellular Na+ content and reduced intracellular K+ content, which would lead to membrane depolarization (21). The observed undershoot in intracellular Na+ content in muscles exposed to two stimulation bouts followed by a 10-min recovery, compared with that in resting muscles, reflects excitation-induced activation of the Na+-K+-ATPase (26). This finding suggests that the first 10-s stimulation bout was sufficient to increase Na+-K+-ATPase activity for at least 20 min. If the excitation-induced increase in intracellular Na+ content is involved in triggering the increase in Na+-K+-ATPase mRNA expression, it is surprising that such a short-lasting event is a sufficient signal. Although not measured in the present study, it is well-documented that there is an elevation in baseline cytosolic Ca2+ concentration with repeated muscle contractions in isolated mammalian muscle (44).

Ouabain, veratridine, and monensin increased intracellular Na+ content but did not increase the mRNA expression of any of the Na+-K+-ATPase isoforms.

Despite a clear increase in intracellular Na+ content with each of ouabain (120 min, 1.0 mM), veratridine (30 min, 0.1 mM), and monensin (30 min, 0.1 mM), there was no significant increase in the mRNA expression of any of the Na+-K+-ATPase isoforms. These findings are in contrast to those with cultured rat kidney cells, where 45–60 min of incubation with ouabain (0.1 mM) induced a ∼100% increase in the mRNA expression of both the α1- and β1-isoforms (36). Furthermore, in cultured chicken skeletal muscle cells, 5–30 h of exposure to veratridine (0.01 mM) induced a 70 and 150% increase in the mRNA expression of the α- and β-subunit isoforms, respectively (42). It is unlikely that the incubation periods used in the present study were insufficient because large elevations (598–769%) in intracellular Na+ content were induced. Furthermore, the interventions used to increase intracellular Na+ content would have induced membrane depolarization in isolated skeletal muscle (6) in the present study and also in cell cultures (4) used in the previous studies (36, 42). As such, differences between this and previous studies (36, 42) regarding the effect of elevated intracellular Na+ content on the mRNA expression of the Na+-K+-ATPase isoforms probably reflect differences in the preparations (isolated whole muscle vs. cultured cells) and species and tissues used (rat skeletal muscle vs. chicken skeletal muscle and rat kidney). In fact, ouabain reduced the mRNA expression of the β2- and β3-isoforms, veratridine reduced the mRNA expression of the α2- and β3-isoforms, and monensin also reduced the mRNA expression of the β3-isoform. It therefore is probable that mRNA expression of the α2-, β2-, and β3-isoforms may be negatively related to intracellular Na+ content. On the other hand, because intermittent electrical stimulation was also shown to increase intracellular Na+ content, as well as the mRNA expression of the Na+-K+-ATPase α-subunit isoforms, the lack of elevation in mRNA expression of any of the Na+-K+-ATPase isoforms with ouabain, veratridine, or monensin may have been because of the sustained increase in intracellular Na+ content. Thus increases in intracellular Na+ content may need to be intermittent in nature to elevate the mRNA expression of the Na+-K+-ATPase isoforms in isolated skeletal muscle.

It should be noted that, in skeletal muscle from rats, mice, and guinea pigs, an increase in intracellular Na+ induced by dietary K+ deficiency leads to a marked downregulation of the content of Na+-K+-ATPase enzymes, measured as [3H]ouabain binding capacity (30) or as α2-isoform protein abundance (1). This would suggest that elevated intracellular Na+ under some conditions elicits downregulation of Na+-K+-ATPase mRNA expression. Indeed, Azuma et al. (1) showed that, in skeletal muscle from K+-deficient rats, mRNA expression of the α2-isoform was reduced by 35%. In the present study, Na+ loading with veratridine decreased mRNA expression of the α2-isoform by 69%, whereas Na+ loading with ouabain induced a nonsignificant 47% reduction in mRNA expression of the α2-isoform. These changes are in keeping with the downregulation seen in K+-deficient rats. The physiological significance of this relationship and the cellular changes involved in reducing the mRNA expression of the β2- and β3-isoforms are unclear and require further investigation.

Furthermore, the lack of increase in mRNA expression of the Na+-K+-ATPase isoforms with interventions utilized to increase intracellular Na+ content is unlikely to be due to a reduction in intracellular Ca2+ content. In rat soleus muscle, ouabain (120 min, 1.0 mM) increased intracellular Na+ content, induced a small increase in 45Ca uptake, and had no effect on muscle Ca2+ content (12). Additionally, in rat EDL muscle, veratridine (15 min, 0.1 mM) increased 45Ca uptake by 139% (12). Thus, if there were any changes in intracellular Ca2+ content, it would have been elevated rather than reduced, with the interventions used here to increase intracellular Na+ content.

13 mM [K+]o increased mRNA expression of the α1-isoform.

The elevation of [K+]o to levels mimicking those occurring in contracting muscle during exercise (41) induced an increase in the mRNA expression of the α1-isoform and a tendency (P = 0.055) toward an increased mRNA expression of the β3-isoform but had no significant effect on the mRNA expression of any of the α2-, α3-, β1-, or β2-isoforms. In rat liver cells, low [K+]o (0.65 mM) was shown to increase the mRNA expression of the α-subunit isoform by 250% (35), whereas in canine kidney cells, an even lower [K+]o (0.25 mM) induced a 200% increase in the mRNA expression of both the α- and β-subunit isoforms (3). Because such low [K+]o would have actually depolarized the muscle (10) and the 13 mM [K+]o used in the present study would have also depolarized the muscle (13), these results suggest that membrane depolarization may increase the mRNA expression of the Na+-K+-ATPase isoforms in both cultured cells and isolated muscles.

The effects of membrane depolarization on the mRNA expression of the Na+-K+-ATPase isoforms is unlikely to be due to any increase in intracellular Ca2+ content. In skinned fibers from rat EDL muscle, membrane depolarization induced via reduction of intracellular K+ concentration decreased sarcoplasmic reticulum Ca2+ release, as indicated by a reduction in twitch force (28), whereas in isolated rat EDL muscles, 30-min incubation in 20 mM [K+]o had no significant effect on 45Ca uptake (9). It therefore appears that intracellular Ca2+ content was more likely to have been reduced, rather than elevated, with the membrane depolarization induced here with 13 mM [K+]o.

A-23187 increased mRNA expression of the α3-isoform but reduced mRNA expression of the β1-isoform.

The Ca2+ ionophore A-23187 (0.02 mM) was used to induce an elevation in intracellular Ca2+ content and/or Ca2+ influx. Indeed, in isolated rat EDL muscle, only 15 min of incubation with 0.02 mM A-23187 significantly increased 45Ca uptake by 323% (11). Additionally, in cultured rabbit myocytes, only 10 min of incubation with 0.4 μM A-23187 was sufficient to increase intracellular free Ca2+ content by 200–900% (16). In the present study, A-23187 induced complex changes in the mRNA expression of the Na+-K+-ATPase isoforms, by increasing the mRNA expression of the α3-isoform, reducing the mRNA expression of the β1-isoform, and having no significant effect on the mRNA expression of any of α1-, α2-, β2-, or β3-isoforms. These findings are in contrast to the 300% elevations in the mRNA expression of both the α1- and β1-isoforms found in rat kidney cells after 1-h incubation in solution containing 1.0 μM Ca2+ compared with that containing 0.1 μM Ca2+ (37). In that study, the author confirmed that the increase in extracellular Ca2+ (0.1–1.0 μM) also induced an increase in intracellular Ca2+ (0.1–4.0 μM). However, the validity of those results is uncertain because the extracellular Ca2+ concentrations used in that study are nonphysiologically low, with the normal resting extracellular Ca2+ concentration being 1.0–1.5 mM, as utilized here.

The physiological significance of an elevation in the mRNA expression of the α3-isoform and a reduction in the mRNA expression of the β1-isoform in response to increased intracellular Ca2+ content and/or Ca2+ influx is unclear. Nonetheless, because the relative mRNA expression of the α3-isoform in skeletal muscle is likely to be low (29), the quantitative importance of an increase in the mRNA expression of the α3-isoform is uncertain.

Importantly, the effects of A-23187 on the mRNA expression of the Na+-K+-ATPase isoforms were unlikely to be due to any A-23187-induced contracture because no increase in baseline tension was previously found with application of A-23187 (11). Although the mechanisms responsible for the elevation in mRNA expression of the α3-isoform and the reduction in mRNA expression of the β1-isoform with A-23187 are unknown, they may involve altered rates of transcription and degradation, respectively. In rat kidney cells, the elevation in mRNA expression of the α1-isoform with an increase in extracellular Ca2+ concentration could almost completely be accounted for by an acceleration in the transcription rate of the α1-isoform (37). On the other hand, the effect of an increase in extracellular Ca2+ concentration on the mRNA expression of the β1-isoform was thought to be mediated by an altered degradation rate of the β1-isoform. However, in that study, an increase in extracellular Ca2+ concentration was thought to attenuate the degradation rate of the β1-isoform.

Perspectives

The functional significance of an increase in mRNA expression of the Na+-K+-ATPase isoforms with three bouts of 10-s electrical stimulation is uncertain. In isolated rat soleus and EDL muscles, protein expression of the Na+-K+-ATPase α2-isoform was unchanged with up to 240 min of electrical stimulation (22). In human vastus lateralis muscle, [3H]ouabain binding was not changed after 72 min of exercise (19) but was increased by 13% with ∼10 h of running (32). It therefore appears that a time course discrepancy exists between the mRNA and protein expression of the Na+-K+-ATPase. Thus mRNA expression of the Na+-K+-ATPase may be elevated with only 30 s of repeated muscle contractions, whereas the protein expression of the functional Na+-K+-ATPase may only be elevated after several hours of repeated muscle contractions.

The mRNA expression of the Na+-K+-ATPase isoforms appears to be regulated by different stimuli in rat skeletal muscle. In the EDL, a muscle comprising predominantly fast-twitch fibers, the present study suggests that membrane depolarization and elevated intracellular Ca2+ content and/or Ca2+ influx may induce increased mRNA expression of the α1- and α3-isoforms, respectively. Thus other factors not explored in this study may be responsible for inducing the increased mRNA expression of the other Na+-K+-ATPase isoforms observed after electrical stimulation and exercise. This may include increased reactive oxygen species (ROS) since repeated muscle contractions increase ROS in both rat and human muscle (15, 39). Furthermore, there is accumulating evidence that increased ROS may act as a second messenger in signaling pathways involved in the mRNA expression of the cardiac Na+-K+-ATPase (45). Further work is required to investigate the role of increased ROS in the mRNA expression of the Na+-K+-ATPase isoforms in skeletal muscle.

In conclusion, the effects of three bouts of high-frequency electrical stimulation on the mRNA expression of the Na+-K+-ATPase isoforms in rat EDL muscle were subunit specific, with increases in mRNA expression of the α-isoforms but not of the β-isoforms. Furthermore, mRNA expression of the Na+-K+-ATPase isoforms appears to be regulated by different stimuli, including the cellular changes associated with high [K+]o such as membrane depolarization, as well as with A-23187 such as elevated intracellular Ca2+ content and/or Ca2+ influx. Surprisingly, there was no increase in the mRNA expression of any of the Na+-K+-ATPase isoforms with interventions used to elevate intracellular Na+ content but rather a decreased mRNA expression of several isoforms. Thus a surprising diversity of signals appears to be involved in upregulating the mRNA expression of the different Na+-K+-ATPase isoforms. However, this is consistent with the expression of multiple isoforms, with presumably a corresponding diversity in function.

GRANTS

This study was supported by grants from the National Health and Medical Research Council of Australia, The Foundation for Young Australians, and The Lundbeck Foundation.

FOOTNOTES

  • The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Ann-Charlotte Andersen, Marianne Stürup Johansen, Tove Lindahl Andersen, and Vibeke Uhre for skilled technical assistance and Associate Professor Ole Bækgaard Nielsen at the University of Aarhus for the planning of the Na+ washout experiments. We also thank Dr. Rodney Snow and Dr. Cameron-Smith at Deakin University, Melbourne, for the use of their laboratory to conduct the mRNA analyses.

REFERENCES

  • 1 Azuma K, Hensley C, Putnam D, and McDonough A. Hypokalemia decreases Na+-K+-ATPase α2- but not α1-isoform abundance in heart, muscle, and brain. Am J Physiol Cell Physiol 260: C958–C964, 1991.
    Link | ISI | Google Scholar
  • 2 Bortolotto SK, Cellini M, Stephenson DG, and Stephenson GM. MHC isoform composition and Ca2+- or Sr2+-activation properties of rat skeletal muscle fibers. Am J Physiol Cell Physiol 279: C1564–C1577, 2000.
    Link | ISI | Google Scholar
  • 3 Bowen JW and McDonough A. Pretranslational regulation of Na-K-ATPase in cultured canine kidney cells by low K+. Am J Physiol Cell Physiol 252: C179–C189, 1987.
    Link | ISI | Google Scholar
  • 4 Brodie C and Sampson SR. Veratridine-induced oscillations in membrane potential of cultured rat skeletal muscle: role of the Na-K pump. Cell Mol Neurobiol 10: 217–226, 1990.
    Crossref | PubMed | ISI | Google Scholar
  • 5 Clausen T, Andersen SL, and Flatman JA. Na+-K+ pump stimulation elicits recovery of contractility in K+-paralysed rat muscle. J Physiol 472: 521–536, 1993.
    Crossref | PubMed | ISI | Google Scholar
  • 6 Clausen T and Flatman JA. The effect of catecholamines on Na-K transport and membrane potential in rat soleus muscle. J Physiol 270: 383–414, 1977.
    Crossref | PubMed | ISI | Google Scholar
  • 7 Delp MD and Duan C. Composition and size of type I, IIA, IID/X, and IIB fibers and citrate synthase activity of rat muscle. J Appl Physiol 80: 261–270, 1996.
    Link | ISI | Google Scholar
  • 8 Everts ME and Clausen T. Activation of the Na-K pump by intracellular Na in rat slow- and fast-twitch muscle. Acta Physiol Scand 145: 353–362, 1992.
    Crossref | PubMed | Google Scholar
  • 9 Everts ME and Clausen T. Effects of thyroid hormones on calcium contents and 45Ca exchange in rat skeletal muscle. Am J Physiol Endocrinol Metab 251: E258–E265, 1986.
    Link | ISI | Google Scholar
  • 10 Geukes Foppen RJ and Siegenbeek Van Heukelom J. Isoprenaline-stimulated differential adrenergic response of K+ channels in skeletal muscle under hypokalaemic conditions. Pflügers Arch 446: 239–247, 2003.
    Crossref | PubMed | ISI | Google Scholar
  • 11 Gissel H and Clausen T. Ca2+ uptake and cellular integrity in rat EDL muscle exposed to electrostimulation, electroporation, or A-23187. Am J Physiol Regul Integr Comp Physiol 285: R132–R142, 2003.
    Link | ISI | Google Scholar
  • 12 Gissel H and Clausen T. Excitation-induced Ca2+ influx in rat soleus and EDL muscle: mechanisms and effects on cellular integrity. Am J Physiol Regul Integr Comp Physiol 279: R917–R924, 2000.
    Link | ISI | Google Scholar
  • 13 Hansen AK, Clausen T, and Nielsen OB. Effects of lactic acid and catecholamines on contractility in fast-twitch muscles exposed to hyperkalemia. Am J Physiol Cell Physiol 289: C104–C112, 2005.
    Link | ISI | Google Scholar
  • 14 Holmes TH. Ten categories of statistical errors: a guide for research in endocrinology and metabolism. Am J Physiol Endocrinol Metab 286: E495–E501, 2004.
    Link | ISI | Google Scholar
  • 15 Jackson MJ, Edwards RH, and Symons MC. Electron spin resonance studies of intact mammalian skeletal muscle. Biochim Biophys Acta 847: 185–190, 1985.
    Crossref | PubMed | ISI | Google Scholar
  • 16 Kubis HP, Haller EA, Wetzel P, and Gros G. Adult fast myosin pattern and Ca2+-induced slow myosin pattern in primary skeletal muscle culture. Proc Natl Acad Sci USA 94: 4205–4210, 1997.
    Crossref | PubMed | ISI | Google Scholar
  • 17 Kubis HP, Haller EA, Wetzel P, and Gros G. Adult fast myosin pattern and Ca2+-induced slow myosin pattern in primary skeletal muscle culture. Proc Natl Acad Sci USA 94: 4205–4210, 1997.
    Crossref | PubMed | ISI | Google Scholar
  • 18 Lavoie L, Levenson R, Martin-Vasallo P, and Klip A. The molar ratios of α and β subunits of the Na+-K+-ATPase differ in distinct subcellular membranes from rat skeletal muscle. Biochemistry 36: 7726–7732, 1997.
    Crossref | PubMed | ISI | Google Scholar
  • 19 Leppik JA, Aughey RJ, Medved I, Fairweather I, Carey MF, and McKenna MJ. Prolonged exercise to fatigue in humans impairs skeletal muscle Na+-K+-ATPase activity, sarcoplasmic reticulum Ca2+ release, and Ca2+ uptake. J Appl Physiol 97: 1414–1423, 2004.
    Link | ISI | Google Scholar
  • 20 Lindinger MI and Heigenhauser GJ. Ion fluxes during tetanic stimulation in isolated perfused rat hindlimb. Am J Physiol Regul Integr Comp Physiol 254: R117–R126, 1988.
    Link | Google Scholar
  • 21 Macdonald WA, Nielsen OB, and Clausen T. Na+-K+ pump stimulation restores carbacholine-induced loss of excitability and contractility in rat skeletal muscle. J Physiol 563: 459–469, 2005.
    Crossref | PubMed | ISI | Google Scholar
  • 22 McKenna MJ, Gissel H, and Clausen T. Effects of electrical stimulation and insulin on Na+-K+-ATPase [3H]ouabain binding in rat skeletal muscle. J Physiol 547: 567–580, 2003.
    Crossref | PubMed | ISI | Google Scholar
  • 23 Murphy KT, Petersen AC, Goodman C, Gong X, Leppik JA, Garnham AP, Cameron-Smith D, Snow RJ, and McKenna MJ. Prolonged submaximal exercise induces isoform-specific Na+,K+-ATPase mRNA and protein responses in human skeletal muscle. Am J Physiol Regul Integr Comp Physiol 290: R414–R424, 2006.
    Link | ISI | Google Scholar
  • 24 Murphy KT, Snow RJ, Petersen AC, Murphy RM, Mollica J, Lee JS, Garnham AP, Aughey RJ, Leppik JA, Medved I, Cameron-Smith D, and McKenna MJ. Intense exercise up-regulates Na+,K+-ATPase isoform mRNA, but not protein expression in human skeletal muscle. J Physiol 556: 507–519, 2004.
    Crossref | PubMed | ISI | Google Scholar
  • 25 Murphy RM, Watt KK, Cameron-Smith D, Gibbons CJ, and Snow RJ. Effects of creatine supplementation on housekeeping genes in human skeletal muscle using real-time RT-PCR. Physiol Genomics 12: 163–174, 2003.
    Link | ISI | Google Scholar
  • 26 Nielsen OB and Clausen T. Regulation of Na+-K+ pump activity in contracting rat muscle. J Physiol 503: 571–581, 1997.
    Crossref | PubMed | ISI | Google Scholar
  • 27 Nielsen OB and Clausen T. The significance of active Na+,K+ transport in the maintenance of contractility in rat skeletal muscle. Acta Physiol Scand 157: 199–209, 1996.
    Crossref | PubMed | Google Scholar
  • 28 Nielsen OB, Ørtenblad N, Lamb GD, and Stephenson DG. Excitability of the T-tubular system in rat skeletal muscle: roles of K+ and Na+ gradients and Na+-K+ pump activity. J Physiol 557: 133–146, 2004.
    Crossref | PubMed | ISI | Google Scholar
  • 29 Nordsborg N, Thomassen M, Lundby C, Pilegaard H, and Bangsbo J. Contraction-induced increases in Na+-K+-ATPase mRNA levels in human skeletal muscle are not amplified by activation of additional muscle mass. Am J Physiol Regul Integr Comp Physiol 289: R84–R91, 2005.
    Link | ISI | Google Scholar
  • 30 Nørgaard A, Kjeldsen K, and Clausen T. Potassium depletion decreases the number of 3H-ouabain binding sites and the active Na-K transport in skeletal muscle. Nature 293: 739–741, 1981.
    Crossref | PubMed | ISI | Google Scholar
  • 31 Orlowski J and Lingrel JB. Tissue-specific and developmental regulation of rat Na,K-ATPase catalytic α isoform and β subunit mRNAs. J Biol Chem 263: 10436–10442, 1988.
    PubMed | ISI | Google Scholar
  • 32 Overgaard K, Lindstrom T, Ingemann-Hansen T, and Clausen T. Membrane leakage and increased content of Na+-K+ pumps and Ca2+ in human muscle after a 100-km run. J Appl Physiol 92: 1891–1898, 2002.
    Link | ISI | Google Scholar
  • 33 Overgaard K, Nielsen OB, and Clausen T. Effects of reduced electrochemical Na+ gradient on contractility in skeletal muscle: role of the Na+-K+ pump. Pflügers Arch 434: 457–465, 1997.
    Crossref | PubMed | ISI | Google Scholar
  • 34 Pilegaard H, Ordway GA, Saltin B, and Neufer PD. Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise. Am J Physiol Endocrinol Metab 279: E806–E814, 2000.
    Link | ISI | Google Scholar
  • 35 Pressley TA, Ismail-Beigi F, Gick GG, and Edelman IS. Increased abundance of Na+-K+-ATPase mRNAs in response to low external K+. Am J Physiol Cell Physiol 255: C252–C260, 1988.
    Link | ISI | Google Scholar
  • 36 Rayson B. Calcium: a mediator of the cellular response to chronic Na+/K+-ATPase inhibition. J Biol Chem 268: 8851–8854, 1993.
    PubMed | ISI | Google Scholar
  • 37 Rayson BM. [Ca2+]i regulates transcription rate of the Na+/K+-ATPase α1 subunit. J Biol Chem 266: 21335–21338, 1991.
    PubMed | ISI | Google Scholar
  • 38 Sejersted OM and Sjøgaard G. Dynamics and consequences of potassium shifts in skeletal muscle and heart during exercise. Physiol Rev 80: 1411–1481, 2000.
    Link | ISI | Google Scholar
  • 39 Silveira LR, Pereira-Da-Silva L, Juel C, and Hellsten Y. Formation of hydrogen peroxide and nitric oxide in rat skeletal muscle cells during contractions. Free Radic Biol Med 35: 455–464, 2003.
    Crossref | PubMed | ISI | Google Scholar
  • 40 Sjøgaard G, Adams RP, and Saltin B. Water and ion shifts in skeletal muscle of humans with intense dynamic knee extension. Am J Physiol Regul Integr Comp Physiol 248: R190–R196, 1985.
    Link | ISI | Google Scholar
  • 41 Street D, Nielsen JJ, Bangsbo J, and Juel C. Metabolic alkalosis reduces exercise-induced acidosis and potassium accumulation in human skeletal muscle interstitium. J Physiol 28: 28, 2005.
    Google Scholar
  • 42 Taormino JP and Fambrough DM. Pre-translational regulation of the (Na+ + K+)-ATPase in response to demand for ion transport in cultured chicken skeletal muscle. J Biol Chem 265: 4116–4123, 1990.
    PubMed | ISI | Google Scholar
  • 43 Tsakiridis T, Wong PP, Liu Z, Rodgers CD, Vranic M, and Klip A. Exercise increases the plasma membrane content of the Na+ -K+ pump and its mRNA in rat skeletal muscles. J Appl Physiol 80: 699–705, 1996.
    Link | ISI | Google Scholar
  • 44 Westerblad H, Duty S, and Allen DG. Intracellular calcium concentration during low-frequency fatigue in isolated single fibers of mouse skeletal muscle. J Appl Physiol 75: 382–388, 1993.
    Link | ISI | Google Scholar
  • 45 Xie Z, Kometiani P, Liu J, Li J, Shapiro JI, and Askari A. Intracellular reactive oxygen species mediate the linkage of Na+/K+-ATPase to hypertrophy and its marker genes in cardiac myocytes. J Biol Chem 274: 19323–19328, 1999.
    Crossref | PubMed | ISI | Google Scholar

AUTHOR NOTES

  • Address for reprint requests and other correspondence: K. T. Murphy, Institute of Physiology and Biophysics, Univ. of Aarhus, Ole Worms Allé 160, DK-8000 Århus C, Denmark (e-mail: )