regional distribution of fat tissue varies considerably, even among individuals with the same total body fat content. For several decades, it has been appreciated that fat tissue is regionally heterogeneous with respect to metabolic function (2, 29, 30). Fat cells isolated from different depots of rats and humans differ in size, responses to insulin and lipolytic agents, lipoprotein lipase release, lipid synthetic capacity, fatty acid incorporation, and other characteristics (2, 6, 11, 14, 18,23, 36, 37, 47, 53, 56, 58). These observations lead to the following question: Is interdepot variation solely a result of influences extrinsic to adipose cells (including their hormonal and paracrine microenvironment, local nutrient availability, innervation, and anatomic constraints), or do intrinsic differences in the innate characteristics of adipose cells also contribute? The latter may be the case because regional variation in capacity for differentiation of preadipocytes cultured in identical conditions originating from various depots from the same individuals has been observed (1, 9, 10, 19,32, 33, 61). A problem with the studies of effects of fat depot origin on human preadipocyte differentiation is that interdepot differences in extent of contamination of primary cultures with nonadipose cell types, such as mesothelial cells and fibroblasts, are a potential cause of apparent differences in adipogenesis. Additionally, it has not been clear if interdepot differences in human preadipocyte capacity for differentiation depend on variation at the level of adipogenic transcription factor expression or solely on later events during the differentiation process.

To explore the cellular and molecular basis for regional differences in human preadipocyte function, we determined effects of fat depot origin on the key adipogenic transcription factors, peroxisome proliferator activated receptor-γ (PPAR-γ) and CCAAT/enhancer binding protein-α (C/EBP-α), and downstream targets, glycerol-3-phosphate dehydrogenase (G3PD) and adipocyte fatty acid binding protein (aP2), in abdominal subcutaneous, mesenteric, and omental preadipocytes. Abdominal subcutaneous and omental preadipocytes were studied for the following reasons. Differences in lipid accumulation, lipogenic enzyme activities, and function of preadipocytes and fat cells isolated from these depots have been found (1, 6, 11, 23, 47, 53). Increased visceral relative to subcutaneous fat is associated with increased risk of atherosclerosis, diabetes, hypertension, and dyslipidemia (5, 8, 15, 16, 25, 35-37, 40, 44, 51). Little is known about the characteristics of preadipocytes from the other major visceral fat depot, the mesenteric depot, which were therefore also studied.

METHODS

Human subjects.

Fat tissue was resected during gastric bypass surgery for management of obesity from 16 subjects who had given informed consent. The protocol was approved by the Boston University Medical Center Institutional Review Board for Human Research. All subjects had fasted at least 10 h. Four of the subjects were men and 12 were women. Subjects were 42 ± 2 yr of age (mean ± SE; range 29–61). The subjects' mean body mass index was 54 ± 2 kg/m². Subjects with malignancies were excluded. No subjects were taking thiazolidinediones or steroids. None had fasting plasma glucose levels over 120 mg%. Two to 10 g of abdominal subcutaneous (external to the fascia superficialis), mesenteric, and greater omental fat were obtained from each subject.

Preadipocyte culture.

Fat tissue was minced and then digested in Hanks' balanced salt solution containing 1 mg/ml collagenase and 7.5% fetal bovine serum (FBS) in a 37°C shaking water bath until fragments were no longer visible and the digest had a milky appearance. Digests were filtered and centrifuged at 800 g for 10 min. The digests were treated with an erythrocyte lysis buffer to improve subsequent differentiation (20, 60). The cells were then plated by using a low-serum plating medium (1:1 DMEM:Ham's F12 that contained 0.5% bovine serum and antibiotics) at a density of 4 × 10⁴ cells/cm². Macrophages were rare (<5 per 10⁶ cells as assessed by phase-contrast microscopy) in the replated cultures, irrespective of fat depot origin. Plating medium was changed every 2 days until confluence.

Preadipocyte cloning.

Preadipocytes were isolated as described above and were plated at a density of 50 cells/96-well plate in plating medium. At this density, the probability of any one well's being seeded by more than one cell is <2% (32, 61). After 2 wk, colonies were evident and by 3 wk, some were near confluence. Cloning efficiency ranged from 10 to 30%. From 3 wk, the clones were exposed to the differentiation-inducing medium described below. The percentage of clones that contained at least one differentiated cell was determined 15, 30, 45, and 60 days after addition of differentiation-inducing medium by observers who did not know the fat depot origin of the cultures. Also, the percentage of cells within each of the colonies that had differentiated was determined after 30 days. A differentiated cell was considered to be one that contained doubly refractile inclusions visible by low-power phase-contrast microscopy, as previously described in cloned rat preadipocyte studies (32,61). The lipid nature of these inclusions was confirmed by staining with oil red O. Human lung fibroblasts cultured under identical conditions never developed such lipid inclusions after up to 60 days of treatment with differentiation-inducing medium.

Preadipocyte differentiation.

From confluence, first to fourth passage cells were either held in an undifferentiated state by using plating medium without serum, or were differentiated. For differentiation, a previously published method (21) was used with modifications that included the following. Mass cultures were treated for 7–10 days (4 h to 14 days in differentiation time course experiments) and clones for up to 60 days (as indicated in results and figure legends) with plating medium (without serum) enriched with 100 nM dexamethasone, 500 nM human insulin, 200 pM triiodothyronine, 0.5 μM rosiglitazone, antibiotics, and 540 μM IBMX (removed after 2 days). In preliminary studies, higher rosiglitazone and insulin concentrations did not further enhance differentiation of subcutaneous, mesenteric, or omental preadipocytes. Medium was changed every 2 days in mass cultures and weekly in clones.

DNA transfection.

Omental preadipocytes were cotransfected with pMT2rC/EBP-α and pMSV-βgal (Invitrogen) at a by molar ratio of 5:1 (transcription factor:reporter construct) by using the calcium phosphate precipitation method (62) without glycerol shock treatment to ensure that transfected cells detected by staining for β-galactosidase would also be expressing C/EBP-α. Approximately 15% of transfected cells were positive for β-galactosidase. Increased C/EBP-α expression in transfected cells was verified by Western immunoanalysis. Mock-control cells were transfected with a plasmid, PVG 9607(GAPDH) (41), that expresses glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and that had no effect on lipid accumulation compared with untransfected cells, and pMSV-βgal, also at a 5:1 molar ratio. After 48 h of culture in differentiation medium, cultures were fixed in 3% formaldehyde and stained with the chromatographic β-galactosidase substrate, x-gal, to identify transfected cells (57). Observers unaware of the origin of the cells assessed extent of differentiation by examining transfected cells for the presence of doubly refractile lipid inclusions by using low-power phase-contrast microscopy (32, 61). The proportion of transfected cells containing such inclusions was compared with that of parallel mock-control cultures.

Glycerol-3-phosphate dehydrogenase.

Glycerol-3-phosphate dehydrogenase (G3PD) was measured in supernatants of cell homogenates by following NADH disappearance spectrophotometrically (39), as described previously (34). G3PD activity was below the detection limit of our assay in undifferentiated cells.

Western immunoblot analyses.

Cultures were washed with PBS and scraped into RIPA buffer (64). SDS-PAGE was performed (43). The protein was transferred to Immobilon polyvinylidene difluoride membranes for probing, and the gels were stained to visualize banding and confirm protein integrity. Blotting paper was blocked for 1 h at room temperature in Tris-buffered saline containing 5% milk, 0.5% BSA, and 0.1% Tween 20. Incubation with anti-aP2 primary antibody (kindly provided by D. A. Bernlohr) was for 1 h at 24°C and with anti-PPAR-γ antibody [cat. no. sc-7273 (E-8), Santa Cruz Biotechnology, Santa Cruz, CA] was for 4 h (45). Blots were incubated for 30 min at room temperature with secondary antibody conjugated to horseradish peroxidase. Visualization of secondary antibody binding was performed by chemiluminescence. Five micrograms of protein were loaded in each lane for measuring aP2 and 20 μg for measuring PPAR-γ. In preliminary studies, linearity was confirmed over the range of aP2 and PPAR-γ levels encountered in preadipocytes when these amounts of protein were loaded. Total protein contents (pg/cell) were 305 ± 32 and 310 ± 38 in undifferentiated and differentiated preadipocytes, respectively. Protein was quantified by densitometry.

Confocal immunofluorescence studies.

Abdominal subcutaneous, mesenteric, and omental preadipocyte clones from three subjects were exposed to differentiation medium for 15, 55, and 55 days, respectively. The clones were washed twice with PBS, fixed in 1% paraformaldehyde for 20 min, and washed again with water. The clones were incubated for 10 min in DAKO serum-free protein blocking buffer (cat. no. X0909, DAKO, Carpinteria, CA) and 0.1% saponin (cat. no. S-7900, Sigma Chemicals, St. Louis, MO). Next, the clones were incubated for 1 h in 50 μl of a 1:37.5 dilution of rabbit polyclonal anti-C/EBP-α antibody (cat. no. sc-61, Santa Cruz Biotech) at room temperature, washed in PBS, and fluorescently labeled in a 1:200 dilution of a chicken anti-rabbit antibody conjugated with Alexa Fluor 488 fluorochrome (A-21441, Molecular Probes, Eugene, OR). After a final wash with PBS, images of the labeled cells were immediately collected on an LSM510 confocal system (Zeiss, Oberkochen, Germany) equipped with an Axiovert 100M inverted microscope and an LD-Achroplan 40×/0.6 NA objective lens. Excitation was from the 488-nm line of an argon/krypton laser. Emission was detected above 505 nm.

RNA analysis.

For RNA analyses, RNA was isolated from preadipocytes by using the guanidinium thiocyanate-phenol method (7). RNA integrity was verified by using 1% formaldehyde-containing denaturing agarose gels. mRNA was measured by relative quantitative RT-PCR in which target genes were coamplified with internal control sequences [18S rRNA or hypoxanthine phosphoribosyl transferase (HPRT)] (49). Analysis of mRNA expression was carried out during the exponential phase of the amplification, which was assessed in preliminary experiments for each set of primers. Amplified product reproducibility was confirmed by two PCR rounds. The ratios of intensity of target to internal control bands were used to indicate the relative abundance of message in the samples. This allows quantitative data to be obtained because 18S rRNA and HPRT abundance are not affected by depot origin or differentiation of preadipocytes. 18S rRNA amplification was titrated to match that of PPAR-γ1 and -γ2 by adding competitive primers (Ambion, Austin, TX) that modulate extension of the 18S cDNA. HPRT mRNA abundance was close to that of C/EBP-α. The quantitative nature of this approach was confirmed by measuring the transcription factor mRNAs in serially diluted samples. RNA preparations were checked for DNA contamination by amplifying control aliquots that had not been reverse transcribed. The following primers were used: for PPAR-γ1, sense CTCGAGGACACCGGAGAGG and antisense GCATTATGAGACATCCCCAC (based on sequence accession no. NM002957); for PPAR-γ2, sense GCGATTCCTTCACTGATAC and antisense GCATTATGAGACATCCCCAC (3); for C/EBP-α, sense GACACGCTGCGGGGCATCT and antisense CTGCTCCCCTTCCTTCTCTCA (65); and for HPRT, sense CTTGCTCGAGATGTCATGAAG and antisense GTTTGCATTGTTTTACCAGTG (based on sequence accession no. J00423).

Statistical analysis.

Results are means ± SE, and significance determination was by paired t-tests or ANOVA with post hoc comparisons by Duncan's multiple range test (24, 28). P< 0.05 was considered significant. In transfection experiments, comparisons of numbers of transfected cells were made by logistic regression analysis, with P values determined from log likelihood ratios (38).

RESULTS

Preadipocyte differentiation depends on fat depot origin.

Extent of lipid accumulation was determined in abdominal subcutaneous, omental, and mesenteric preadipocytes that had been isolated from the same subjects. After the preadipocytes had been treated with differentiation-inducing medium for 10 days following confluence, morphologically apparent lipid accumulation was greatest in differentiating abdominal subcutaneous preadipocytes, less extensive in mesenteric cells, and least extensive in omental cells (Fig.1). G3PD activity exhibited a similar pattern. After 10 days of treatment with differentiation medium, primary abdominal subcutaneous preadipocyte G3PD activity was 720 ± 184, mesenteric was 99 ± 47, and omental was 14 ± 4 nmol · s⁻¹ · 10⁶cells⁻¹ (effect of depot origin: P < 0.001; n = 6; ANOVA; subcutaneous > mesenteric or omental, P < 0.05; Duncan's multiple range test).

aP2 expression increases earlier and to a greater extent in subcutaneous than visceral differentiating preadipocytes.

Interdepot variation in aP2 protein abundance exhibited a pattern similar to that of lipid accumulation and G3PD activity (Fig.2). Fourth passage abdominal subcutaneous, mesenteric, and omental preadipocytes were treated for 10 days either with differentiation-inducing medium or a control, basal medium that does not promote differentiation. Abundance of aP2 was higher in abdominal subcutaneous than mesenteric cells (P < 0.01; Duncan's multiple range test;n = 6) and lower in omental than mesenteric preadipocytes (P < 0.01). Undifferentiated cells expressed little aP2 (1.7 ± 1.0, 2.4 ± 1.0, and 2.3 ± 1.3% in abdominal subcutaneous, mesenteric, and omental preadipocytes, respectively; effect of differentiation, P < 0.00001; effect of fat depot origin, P = nonsignificant; ANOVA).

To determine if this interdepot variation in aP2 expression results from a delayed response to inducers of differentiation in omental compared with subcutaneous cells or variation in peak levels achieved, we examined the time course of the differentiation-dependent increase in aP2 protein levels (Fig. 3). We found that aP2 abundance increased earlier during differentiation and to a greater extent in abdominal subcutaneous than omental preadipocytes.

Adipogenic transcription factor expression is higher in differentiating subcutaneous than visceral preadipocytes.

Because adipogenesis in general, and aP2 and G3PD expression in particular, depend on PPAR-γ expression, we measured the time course of PPAR-γ protein expression in abdominal subcutaneous and omental preadipocytes (Fig. 4). Abdominal subcutaneous preadipocytes expressed more PPAR-γ protein, particularly the more adipose-specific PPAR-γ2 isoform, than omental preadipocytes throughout the course of differentiation.

To determine whether variation among depots in preadipocyte PPAR-γ2 expression is pretranslational, PPAR-γ1 and -γ2 mRNA levels were assayed in abdominal subcutaneous, mesenteric, and omental third passage preadipocytes that had been treated with differentiation-inducing medium for 7 days (Fig.5). Both PPAR-γ1 and -γ2 mRNA levels were higher in abdominal subcutaneous than in visceral preadipocytes cultured from the same subjects (abdominal subcutaneous > mesenteric or omental, P < 0.01; n = 5; Duncan's multiple range test). Thus variations in PPAR-γ and aP2 expression, G3PD activity, and lipid accumulation among depots are similar.

Adipogenesis, G3PD activity, and aP2 and PPAR-γ expression are enhanced in rodent preadipocyte cell lines by C/EBP-α (22, 52,63). Interdepot variation in preadipocyte C/EBP-α mRNA abundance in differentiating human preadipocytes mirrored that of PPAR-γ2. C/EBP-α expression was higher in abdominal subcutaneous than mesenteric preadipocytes treated with differentiation-inducing medium for 7 days (Fig. 6;P < 0.01; n = 5; Duncan's multiple range test). C/EBP-α was more abundant in mesenteric than omental preadipocytes (P < 0.01; n = 5; Duncan's multiple range test). Furthermore, C/EBP-α overexpression enhanced lipid accumulation in omental preadipocytes (Fig.7). C/EBP-α and β-gal expression vectors were cotransfected at a 5:1 molar ratio so that only cells transfected with C/EBP-α would be detected by β-gal staining (26). Control cells were transfected with a GAPDH expression vector, also with the β-gal expression vector at a 5:1 molar ratio. After 7 days of treatment with differentiation-inducing medium, the proportions of β-gal-expressing cells that contained doubly refractile lipid inclusions visible by low-power phase-contrast microscopy were determined in C/EBP-α- and control-transfected cultures by observers who were unaware of the treatments performed on the cultures. Over threefold more omental preadipocytes transfected with the C/EBP-α expression vector accumulated lipid than did control cells (odds ratio 3:1; 95% confidence interval 2.1–4.5;P < 0.0001; n = 3 subjects, 100 C/EBP-α- and 100 mock-transfected cells/subject). Thus adipogenesis in omental preadipocytes is augmented by C/EBP-α overexpression, and genes responsible for lipid accumulation are capable of responding to overexpressed levels of C/EBP-α in omental cells.

Cloned preadipocytes exhibit regional differences in adipogenesis.

Stromal vascular digests can contain mesothelial cells, macrophages, and other cell types in addition to preadipocytes. These nonadipose cell types could contribute to apparent regional variation in adipogenesis in primary cultures. To test this possibility, colonies arising from single abdominal subcutaneous, mesenteric, and omental cells cloned by plate dilution from three different patients were exposed to differentiation-inducing medium for 60 days (n = 20–376 clones per fat depot per patient). Regional differences in adipogenesis were evident in these clones (Fig.8). The percentage of colonies that contained at least one differentiated cell (doubly refractile inclusions visible by low-power phase-contrast microscopy) was determined after 15, 30, 45, and 60 days. After 60 days, differentiated cells were found in every colony, confirming the purity of the preadipocyte cultures isolated by using our methods (Fig.9). No such differentiated cells with doubly refractile inclusions were found in human lung fibroblasts cultured under identical conditions. Thus admixture with other cell types does not explain regional differences in adipogenesis.

As in the time course studies of aP2 expression in differentiating mass cultures (Fig. 3), the cloning experiments confirmed that differentiation progresses faster in abdominal subcutaneous than in visceral preadipocytes (Fig. 9). Differentiated cells appeared most rapidly in subcutaneous preadipocyte clones, mesenteric clones were intermediate, and appearance of differentiated cells in omental clones took the longest. Even though colonies were derived from single cells, variation in extent of differentiation was evident among the cells within these colonies for over 60 days after cloning (Figs. 8 and10), much as occurs in mass cultures. The proportion of differentiated cells was highest in abdominal subcutaneous, intermediate in mesenteric, and lowest in omental colonies that had been exposed to differentiation-inducing medium for 30 days (Fig. 10; subcutaneous > mesenteric, and mesenteric > omental, each P < 0.0005; Duncan's multiple range test). Unlike in rodent preadipocyte cell lines, we found that primary human preadipocytes did not need to be confluent to undergo adipogenesis, as previously reported by others (13). Thus interdepot variation in adipogenesis is evident in colonies derived from single preadipocytes, raising the possibility that regional differences in the intrinsic properties of preadipocytes could contribute to the distinct characteristics of fat tissue in different depots.

Differentiated preadipocytes expressed higher levels of C/EBP-α than less differentiated cells, irrespective of fat depot origin (Fig.11). Sixty abdominal subcutaneous, 61 mesenteric, and 37 omental clones from three subjects were treated with C/EBP-α antibody and examined by confocal microscopy. Abdominal subcutaneous clones, which exhibited the most extensive differentiation, were studied after 15 days so that fields containing cells with little lipid accumulation, as well as fields with extensive lipid accumulation, could be examined. By 55 days after induction of differentiation, it was difficult to find subcutaneous clones with fields of cells that did not contain lipid. Visceral preadipocyte clones, in which differentiation occurred later than in subcutaneous clones, were examined after 55 days so fields containing cells with extensive, as well as limited, lipid accumulation could also be examined. We found that those cells with the highest nuclear C/EBP-α expression also exhibited the most differentiated morphology, suggesting that the mechanism responsible for regional differences in adipogenesis operates upstream of C/EBP-α.

DISCUSSION

Fat depot origin affects the capacity of human preadipocytes to differentiate, potentially contributing to regional differences in adipose tissue growth and function. Abdominal subcutaneous cells had the highest adipogenic capacity, as indicated by lipid accumulation, G3PD activity, and aP2, PPAR-γ, and C/EBP-α expression. Mesenteric cells, which have rarely been studied in the past, had an intermediate capacity for adipogenesis, and omental cells had the lowest. Adipogenesis took longer in omental than in subcutaneous cells. In another study, lipid accumulation and G3PD activity were higher in differentiating human abdominal than in femoral subcutaneous preadipocytes (19). Thiazolidinediones (PPAR-γ activating ligands) caused more extensive differentiation of human subcutaneous than omental cells (1). Together, these findings support the hypothesis that fat depot origin affects capacity of preadipocytes to differentiate in humans.

Other differences in the characteristics of human preadipocytes from various depots have been described. Greater susceptibility of human omental than abdominal subcutaneous preadipocytes to apoptosis induced by serum deprivation and tumor necrosis factor-α has been found (50). We found more extensive transfer of fatty acids into differentiated human omental than abdominal subcutaneous preadipocytes from the same subjects, even after matching cells for lipid content, consistent with the greater fatty acid flux in visceral than in subcutaneous fat (6). In these other studies, regional differences in preadipocyte characteristics were evident in cells cultured under identical conditions for up to four subcultures, and in the current study, in colonies arising from single cells for over 60 days. Thus preadipocytes from different regions appear to be inherently distinct.

Rat studies also support the contention that fat cells from different regions are inherently distinct. Preadipocytes cultured from perirenal depots were shown to be capable of more extensive replication and differentiation in vitro and in vivo than preadipocytes from epididymal depots (9, 10, 32, 33, 46, 61). Despite exposure to similar hormonal manipulations in vivo such as estrogen administration, hypophysectomy, or castration, preadipocytes cultured from various depots of rats retained distinct cell dynamic and biochemical responses (31, 42). These depot-dependent differences in the innate characteristics of adipose cells could contribute to anatomic variation in function. Indeed, interdepot variation in cultured rat preadipocyte differentiation-dependent gene expression was reflected in differences among depots in expression of the same genes in fat cells (33). Thus rat preadipocyte studies are in accord with the hypothesis that interdepot variation in fat cell function reflects differences in the innate characteristics of adipose cells themselves, in addition to any effects of variation in nutrient supply, innervation, and other extrinsic factors.

We studied effects of fat depot origin on differentiation of preadipocytes from obese subjects. Because preadipocyte capacities for replication and mitogenic protein release are increased in some massively obese subjects compared with lean controls (54,59), patterns of regional differences in adipogenesis could also be influenced by obesity. Another question arising from this work is whether the pattern of regional variation in adipogenesis of preadipocytes from subjects with peripheral obesity is distinct from that in subjects with visceral obesity. Thus it will be interesting to determine how fat depot origin affects preadipocyte differentiation in lean compared with obese subjects and in subjects with central compared with peripheral obesity.

Lipid accumulation, aP2 expression, and G3PD activity were highest in abdominal subcutaneous preadipocytes, intermediate in mesenteric cells, and lowest in omental cells. Because this pattern was also observed with respect to PPAR-γ and C/EBP-α expression, these associations may be causal because PPAR-γ and C/EBP-α are key adipogenic transcription factors. When either of these factors is absent in transgenic animal models, adipogenesis is blocked. In rodent cell lines, expression of PPAR-γ is linked to that of C/EBP-α, and effects of C/EBP-α and PPAR-γ on adipogenesis are complementary (12). The aP2 and G3PD promoters respond to PPAR-γ and C/EBP-α (4, 22, 52, 55). The magnitudes of the regional differences in C/EBP-α and PPAR-γ expression we found are consistent with the regional differences in aP2 and G3PD abundance. Furthermore, ectopic expression of C/EBP-α in omental preadipocytes enhanced their capacity to accumulate lipid, suggesting that genes downstream of C/EBP-α in omental preadipocytes are capable of responding to overexpressed levels of this adipogenic regulator. These findings suggest that there are mechanisms contributing to regional differences in adipogenesis that operate upstream of the induction of C/EBP-α expression during differentiation.

Others have reported that, even though thiazolidinediones caused more extensive differentiation of subcutaneous than omental cells, PPAR-γ expression was the same in human subcutaneous and omental preadipocytes (1). However, the methods used in these studies were not intended to result in extensive morphologically evident differentiation, unlike the methods we employed, perhaps obscuring potential interdepot differences. Possibly, therefore, the low responsiveness of omental preadipocytes to thiazolidinediones is partly a result of reduced PPAR-γ expression. Regional differences in PPAR-γ abundance and thiazolidinedione responsiveness could be a mechanism contributing to the antidiabetic effects of thiazolidinediones. Excess visceral relative to subcutaneous fat has been associated with glucose intolerance (58). Thiazolidinediones have been reported to promote greater enlargement of subcutaneous than visceral fat (27, 48). This increase in the ratio of subcutaneous to visceral fat may be related to more extensive differentiation of subcutaneous than visceral preadipocytes, potentially improving glucose tolerance.

To exclude possible effects of admixture of other cell types in primary preadipocyte cultures from different regions and to test effects of fat depot origin on adipogenesis definitively, we cloned preadipocytes from different regions. Differences in adipogenesis were evident in colonies derived from single preadipocytes from different fat depots. Differentiated cells appeared later in visceral than subcutaneous clones. Together with our finding that differentiation-dependent increases in aP2 expression are delayed in omental compared with subcutaneous preadipocytes in mass cultures, this indicates that fat depot origin affects the duration of exposure to differentiation-inducing conditions required for adipogenesis to occur. Although adipogenesis is delayed in omental compared with abdominal subcutaneous preadipocytes, it does eventually proceed. This is consistent with the finding that PPAR-γ mRNA abundance is similar in abdominal subcutaneous and omental whole fat tissue samples (1).

Perspectives

The proportion of differentiated cells was lowest in omental, intermediate in mesenteric, and highest in subcutaneous colonies, even though they had originated from single cells. Not every cell within clones differentiated at the same time. Therefore, a stochastic differentiation switch appears to exist. The propensities of preadipocytes from different fat depots in primary cultures to switch on the differentiation program were reflected in colonies derived from single cells. The cloning studies indicate that the likelihood of this switching mechanism to trigger differentiation is a trait transferred to daughter cells, as has been suggested in studies in aneuploid rodent preadipocyte cell lines (17). The switch may operate upstream of the induction of C/EBP-α expression that occurs during adipogenesis, because C/EBP-α overexpression enhanced adipogenesis in visceral preadipocytes, and increased C/EBP-α expression was only observed in individual preadipocytes that also exhibited increased lipid accumulation. If the event responsible for regional differences in adipogenesis only operated downstream of C/EBP-α induction, a high proportion of cells expressing C/EBP-α, but not accumulating lipid, should have been found in omental or mesenteric compared with subcutaneous clones. This stochastic switch could require different thresholds or durations of exposure to differentiation inducers before triggering differentiation. Alternatively, the differentiation process, once triggered, could proceed at different rates depending on fat depot origin. Regional variation in this mechanism appears to be a cause of delayed and less extensive differentiation and responsiveness to thiazolidinediones in visceral compared with subcutaneous preadipocytes.

FOOTNOTES

• This work was supported by National Institutes of Health Grants DK-56891 and AG/DK-13925 (to J. L. Kirkland), DK-46200 (Adipocyte Core; to J. L. Kirkland), DK-59261 (to W. Guo), DK-54588 (to G. Waloga), and DK-45343 (to M. D. Jensen).

• Address for reprint requests and other correspondence: J. L. Kirkland, Room F435, Boston University Medical Center, 88 East Newton St., Boston, MA 02118.

• The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

• 10.1152/ajpregu.00653.2001