Dietary thylakoids reduce visceral fat mass and increase expression of genes involved in intestinal fatty acid oxidation in high-fat fed rats
Abstract
Thylakoids reduce body weight gain and body fat accumulation in rodents. This study investigated whether an enhanced oxidation of dietary fat-derived fatty acids in the intestine contributes to the thylakoid effects. Male Sprague-Dawley rats were fed a high-fat diet with (n = 8) or without thylakoids (n = 8) for 2 wk. Body weight, food intake, and body fat were measured, and intestinal mucosa was collected and analyzed. Quantitative real-time PCR was used to measure gene expression levels of key enzymes involved in fatty acid transport, fatty acid oxidation, and ketogenesis. Another set of thylakoid-treated (n = 10) and control rats (n = 10) went through indirect calorimetry. In the first experiment, thylakoid-treated rats (n = 8) accumulated 25% less visceral fat than controls. Furthermore, fatty acid translocase (Fat/Cd36), carnitine palmitoyltransferase 1a (Cpt1a), and mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase 2 (Hmgcs2) genes were upregulated in the jejunum of the thylakoid-treated group. In the second experiment, thylakoid-treated rats (n = 10) gained 17.5% less weight compared with controls and their respiratory quotient was lower, 0.86 compared with 0.91. Thylakoid-intake resulted in decreased food intake and did not cause steatorrhea. These results suggest that thylakoids stimulated intestinal fatty acid oxidation and ketogenesis, resulting in an increased ability of the intestine to handle dietary fat. The increased fatty acid oxidation and the resulting reduction in food intake may contribute to the reduced fat accumulation in thylakoid-treated animals.
overweight and obesity develops when energy intake chronically exceeds energy expenditure. The abnormal accumulation of body fat in obesity can lead to impaired health (15). Fat accounts for 35–40% of the calories ingested in Western countries (5, 6) even though, according to common recommendations, it should not exceed 30% (43). To find new ways to treat obesity, it is, therefore, essential to target both the excessive intake of dietary fat and the enhanced fat accumulation. Peroxisome proliferator receptor activator-α (PPAR-α) is a nuclear hormone receptor expressed in tissues with a high energy demand, including liver, heart, brown adipose tissue (BAT), and small intestine (19). As a transcription factor PPAR-α regulates biological processes by altering the expression of its numerous target genes. PPAR-α increases the expression of enzymes that promote lipolysis, fatty acid oxidation, and ketogenesis (3). PPAR-α-ligands such as fibrates are currently used for the treatment of hypertriglyceridemia (3, 19). PPAR-α-activation also has therapeutic effects on insulin resistance, glucose homeostasis, and atherosclerosis. Furthermore, pharmacological activation of PPAR-α has been shown to reduce food intake. This eating-inhibitory effect was associated with a decrease in the respiratory quotient (RQ) and with evidence of an enhanced intestinal fatty acid oxidation and ketogenesis (17, 18).
Thylakoids are biological membranes, derived from green-leaf chloroplasts, that have been shown to affect eating and energy metabolism (11), and they may do so, in part, by stimulating the oxidation of diet-derived fatty acids in the intestine. When added to the diet, thylakoid membranes bind to pancreatic lipase and colipase and, thereby, slow down the digestion of fat in the intestine (1, 8). They also form a transient barrier covering the intestinal mucosa, which prolongs nutrient uptake (29). Although all macronutrients, including the dietary fat and the thylakoids themselves, are ultimately digested and absorbed, thylakoids slow down this process substantially (8). Further studies have shown that dietary thylakoids decrease ghrelin levels in man (21) and pig (31) and reduce hunger and cravings for palatable food in man (28, 33, 37–39). Thylakoids have also been shown to increase circulating levels of satiation peptides and decrease food intake, body weight, and fat mass in various species, including humans (1, 9, 21, 22, 28, 30, 31, 39). Specifically, reduced hip circumference in combination with a lower circulating level of leptin in response to thylakoids suggest that they lead to a reduction of body fat also in humans (38). Together with the reduced blood lipid levels found in rodents (1, 22) and man (28, 38), these findings suggest that thylakoids increase fat oxidation.
One site of increased fatty acid oxidation may be the intestine (17, 35). Because thylakoids reduce the rate of fat digestion and fat absorption, they have the possibility to stimulate the fatty acid transport and oxidative systems in the intestine for a longer time. The aim of this study was, therefore, to investigate the effects of long-term treatment with dietary thylakoids in the rat on fatty acid oxidation, examining gene expression levels corresponding to enzymes involved in fatty acid transport and fatty acid oxidation in the intestine and liver. Body composition, body fat pads, blood metabolites, total body energy expenditure, nutrient-substrate utilization, activity levels, body temperature, and fecal fat content were also measured, as well as the activity of drug-metabolizing enzymes in the liver.
MATERIALS AND METHODS
Thylakoids and Diets
Chlorophyll containing green-plant thylakoid membranes used in the study were prepared from spinach leaves using the pH method, as previously described (9), followed by drum drying. One-hundred grams of thylakoids have an energy content of 1,528 kJ and contain 26.1 g protein, 7.2 g fat, 48.7 g carbohydrate, 0.27 g sodium, 2.0 g chlorophyll, 27.9 mg lutein, 0.7 mg zeaxanthine, 3.5 mg β-carotene, 0.021 mg vitamin A, 1.3 mg vitamin K, 6.0 mg vitamin E, and 0.17 mg folic acid. A control high-fat diet (HFD) and a thylakoid-enriched HFD (thylHFD) were used in the experiments (Research Diets, New Brunswick, NJ). The diets were based on the D12451 high-fat diet from Research Diets. The thylHFD contained 33% wt/wt spinach extract (Appethyl, Green Leaf Medical AB, Stockholm, Sweden), which yielded a dose comparable to previous studies in mouse and rat with shown effects on body weight and food intake (1, 22). The energy content was 1,930 kJ/100 g for the HFD and 1,808 kJ/100 g for the thylHFD, the difference was due to the ash and water content of the thylakoid powder. The energy distribution for both diets was 46 E% fat, 18 E% protein, and 36 E% carbohydrates.
Animals and Housing
The study was conducted according to the European Communities regulations concerning protection of experimental animals. Male Sprague-Dawley rats (Charles River) were used, weighing on average 260 g at randomization. The animals were housed in a specific pathogen-free environment, maintained on a 12:12-h light-dark cycle with lights on at 0700, at stable temperature (21 ± 2°C) and relative humidity (50 ± 10%). They had ad libitum access to a standard chow (R36; Lantmännen, Kimstad, Sweden) and tap water until the start of the experiments. The first experiment was performed at the Department of Biology, Lund University, and the animal experiment protocol was approved by the Lund University Ethical Review Committee for Animal Experiments (no. M108-13). The second experiment was performed by the Centre for Physiology and Bio-Imaging, Core Facilities, Sahlgrenska Academy at the University of Gothenburg, Gothenburg, Sweden. The animal experiment protocol was approved by Gothenburg University Ethical Review Committee for Animal Experiments (no. 327-2012).
First experiment: Intestinal Fat Oxidation
Sixteen rats were used for the first experiment, investigating the effects of dietary thylakoids on gene expression of enzymes involved in fatty acid oxidation in the intestine and the liver, body weight, body fat mass, food intake, plasma metabolites, and cytochrome P-450 (CYP) activity in the liver. After 7 days of acclimatization, the rats were housed individually and randomized on the basis of body weight to receive control HFD or thylHFD. To standardize the intake of thylakoids, a fixed amount of 15 g HFD or thylHFD was given to the animals in the afternoon for 13 consecutive days for consumption during the dark period. During the light period, all animals had ad libitum access to HFD without thylakoids. Food intake and body weight were measured daily.
Termination of experiment and sampling procedure.
In the afternoon on day 13, the rats received 3 g of either HFD or thylHFD, after which they were kept fasted until the morning, when they received another 3 g of the same feed 1 h prior to termination of the experiment. The animals were sedated with isoflurane (Baxter Medical AB, Kista, Sweden) and were euthanized by heart puncture and exsanguination. Blood was collected in EDTA tubes and was centrifuged at 3,000 g for 10 min at 4°C. Plasma was collected in cryotubes, frozen, and stored at −80°C for later use. Individual fat pads, mesenteric, epididymal, retroperitoneal, and inguinal subcutaneous white adipose tissue (WAT), interscapular BAT, and livers were dissected and weighed. The mesenteric fat was dissected by stripping the intestine of the fat using blunt dissection with forceps. The epididymal fat pads were removed in their entirety. The retroperitoneal fat pads, extending laterally from the kidneys, were removed from each side. Inguinal subcutaneous fat pads were dissected bilaterally. Livers were cut in pieces and immediately frozen on dry ice and stored at −80°C for later use. Intestinal segments were dissected, each 10 cm in length: duodenum, from the pylorus to the ligament of Treitz, proximal jejunum, next to this segment, and distal ilium, proximal to the cecum. The intestinal segments were washed in ice-cold PBS and were immediately placed on an ice-chilled glass plate, and the mucosa was scraped off using microscope slides, then frozen on dry ice and stored at −80°C for later analysis.
Analyses of plasma metabolites.
Plasma levels of nonesterified fatty acids (NEFA) and β-hydroxybutyrate (BHB) were analyzed at the Department for Clinical Chemistry, Sahlgrenska University Hospital, Gothenburg, Sweden. NEFA were analyzed by an enzymatic colorimetric method using a NEFA-HR kit (Wako Pure Chemical Industries, Osaka, Japan). BHB was analyzed using a locally produced reagent 3-hydroxybutyrate dehydrogenase, which, together with NAD+, converts BHB to acetoacetate, NADH, and H+. The measured amount of NADH is proportional to the amount of BHB. TG levels were analyzed using a Cobas 6000 analyzer (Cobas, Roche, Switzerland) at the Department for Clinical Chemistry, Lund University Hospital, Lund, Sweden.
Quantitative real-time polymerase chain reaction.
RNA was extracted from all intestinal tissues with the TRIzol reagent (15596-018; Ambion by Life Technologies, Zug, Switzerland), treated with DNase (79254; Qiagen, Hombrechtikon, Switzerland), and quantified. One microgram of RNA was used to synthesize cDNA with the high-capacity cDNA RT kit (4368814; Applied Biosystems, Zug, Switzerland). All samples were analyzed by qPCR using FAST SYBR Green master mix (4385617; Applied Biosystems) and the ViiA 7 Real-Time PCR System (Applied Biosystems) (Table 1). Each sample was run in triplicate, analyzed with the 2−ΔΔCT method (24), and normalized against β-actin (Actb) as a reference gene.
| Gene Name | Primer Sequence 5′ to 3′ |
|---|---|
| 3-hydroxy-3-methylglutaryl-CoAsynthase 2 (Hmgcs2) | F - CTGCCTCCCTCTTCAACG |
| R - CACAGACCACCAGGGCATA | |
| Carnitine palmitoyltransferase 1a (Cpt1a) | F - TGATCCCTCAGAGCCACAG |
| R - GGTCTGCCGACACTTTGC | |
| Actin, beta (Actb) | F - CTAAGGCCAACCGTGAAAAG |
| R - GCCTGGATGGCTACGTACA | |
| Fatty acid binding protein 2 (Fabp2) | F - AACTCGGCGTCGACTTTG |
| R - CCAACAAGTTTATTTCCCTCCAT | |
| Acyl-CoA- dehydrogenase, long chain (Acadl/Lcad) | F - GCAGTTACTTGGGAAGAGCAA |
| R - GGCATGACAATATCTGAATGGA | |
| CD36 molecule (Fat/Cd36) | F - GCGACATGATTAATGGCACA |
| R - TGGACCTGCAAATGTCAGAG | |
| Peroxisome proliferator-activated receptor, α (Ppara) | F - CCTCGAACTGGATGACAGTG |
| R - CCCTCCTGCAACTTCTCAAT |
Cytochrome P-450 activity.
Livers were analyzed for determination of cytochrome P-450 (CYP) activity. Probe reactions for CYP1A2 (phenacetin-O-deethylation), CYP2C9 (diclofenac-4′-hydroxylation), CYP2D6 (bufaralol-1′-hydroxylation), and CYP3A4 (midazolam-1′hydroxylation) (36) were studied in liver subcellular fractions (microsomes) from thylakoid-treated and control animals. The preparation of microsomes was carried out as previously described (12). Final protein concentrations were determined in triplicate with a Pierce BCA Protein assay kit (Thermo Scientific, Waltham, MA) using a BSA standard curve.
Microsomes (0.5 mg/ml) from four thylakoid-treated and four control animals were mixed with phosphate buffer (0.1 M, pH 7.4) and incubated in duplicate with a cocktail of phenacetin (30 μM), diclofenac (10 μM), bufuralol (5 μM), and midazolam (3 μM) at 37°C. After 10 min of preincubation, the reactions were initiated with the addition of NADPH (1 mM). Aliquots were taken at 0, 7, 15, 20, 30, and 60 min and quenched with two parts acidified acetonitrile. The samples were centrifuged at 2,737 g for 20 min at 4°C, and the supernatant was diluted 1:2 in H2O prior to analysis. The amounts of O-deethyl-phenacetin, 4′-hydroxy-diclofenac, 1′-hydroxy-bufuralol, and 1′-hydroxy-midazolam formed were determined (see below), and the rates of formation were calculated as picomoles per minute per milligram protein.
LC-MS/MS analysis of CYP probe substrates.
The analysis of the corresponding metabolites from the CYP probe substrates (O-deethyl-phenacetin, 4′-hydroxy-diclofenac, 1′-hydroxy-bufuralol, and 1′-hydroxy-midazolam) was done with LC-MS/MS on a Waters Synapt HDMS mass spectrometer (Waters, Milford, MA) operating under positive electrospray ionization conditions. Leucine-enkephaline was used as a lock mass (m/z 556.2771) for internal calibration. Chromatographic separations were performed on a Waters Acquity UPLC system (Waters) using an Acquity UPLC BEH C18 column (2.1 × 100 mm). The mobile phases consisted of H2O/0.1% formic acid and acetonitrile/0.1% formic acid, and the LC gradient was 10–70% acetonitrile/0.1% formic acid in 6 min at a flow rate of 500 ml/min. All MS data were processed in Metabolynx (Waters, Milford, MA), and the metabolites were quantified with authentic standard curves.
Second Experiment: Indirect Calorimetric Measurements
Twenty rats were used for the second experiment, investigating the effects of dietary thylakoids on energy expenditure, nutrient substrate utilization, and body composition. Upon arrival at the animal facility, the rats were housed together in pairs. After a minimum of 7 days, the rats were sedated with isoflurane (Baxter Medical AB, Kista, Sweden), received the NSAID rimadyl as an analgesic (5 mg/kg ip), and telemetry devices (G2 E-Mitter, MiniMitter, Sunriver, OR) were implanted intraperitoneally, according to the protocol provided by the manufacturer for later measurements of body temperature and activity counts. After 1 wk of recovery, the rats were randomized on the basis of body weight to either a HFD (n = 10) or thylHFD (n = 10) for 14 days with ad libitum access. New food was offered twice a week, and food consumption per cage was monitored. Body weight was measured at baseline (day 0 of HFD-feeding), day 7, day 12 (prior to the indirect calorimetric measurements), and at the end of the study (day 14).
Measurement of RQ.
On day 12 of HFD feeding, the animals were put individually into sealed chambers (SOMEDIC Metabolic System, INCA, Hörby, Sweden) for the measurement of oxygen consumption (V̇o2) and carbon dioxide (V̇co2) production at room temperature for 48 h. The indirect calorimetric measures were combined with the MiniMitter telemetry system recording activity and core body temperature (14). V̇o2, RQ, body temperature, and activity were analyzed for the whole 48-h period, as well as during the second day of the measurements, divided in 6-h bouts, starting at lights on. Oxygen consumption and CO2 production data were collected every 2 min, and the remaining variables were measured every minute. Energy expenditure was calculated from Weir's equation (42).
Body composition analysis.
Immediately following the indirect calorimetry, the animals were injected with pentobarbital sodium intraperitoneally, and a local anesthetic (Lidocaine 0.1 ml and 0.2 ml sc in the neck and stomach). Telemetric probes were removed, and body composition was measured using a minispec LF110 whole body composition analyzer (Bruker's, Doubravnik, Czech Republic).
Fecal analysis.
Fecal droppings were collected from all the rats (n = 10 rats/group) during the 48 h of indirect calorimetry and were dried for later analysis. The fecal samples were analyzed for fat content using acid hydrolysis (Eurofins Food & Feed Testing Laboratory, Linköping, Sweden).
Statistical Analysis
Data were analyzed using the Prism statistical software, version 6 (GraphPad Software, San Diego, CA). Normal distribution was assessed using Shapiro-Wilk normality test. Nonparametrical statistical methods were used for all analyses except for body weight, body weight gain, BCA, indirect calorimetry, and fecal fat content, which were normally distributed and analyzed by t-test, as well as a two-way ANOVA with time and treatment as fixed factors followed by a Bonferroni corrected multiple-comparison test of all individual time points. Linear regression was used to test for differences in slopes or intercepts. In figures and text, data are expressed as median and interquartile range and differences computed by Mann-Whitney U-test, if not otherwise stated. P values < 0.05 were considered statistically significant.
RESULTS
First Experiment: Intestinal Fat Oxidation
Food intake.
All rats but one in the HFD Group finished the 15 g of food administered during the night, every night. In the thylHFD Group, three rats did not finish their 15 g of food on more than one occasion. The thylHFD-fed rats had a lower caloric intake than HFD control rats during the dark hours (P < 0.0001, Fig. 1B), whereas during the daytime, thylakoid rats increased their food intake compared with controls (P < 0.001, Fig. 1C). Overall, supplementation of thylakoids did not affect food intake compared with control measured over the entire experiment (P = 0.72, Fig. 1A). During 24 h, the thylHFD-fed and HFD-fed control rats consumed on average 348 and 360 kJ (median, P = 0.15, Fig. 1D), respectively.
Fig. 1.Thylakoids decreased visceral fat. Food intake and body weight were unaffected. Food intake (A–D): Thylakoids did not affect the overall energy intake during the 14-day experiment compared with controls (A) nor mean daily food intake (D). The reduced caloric intake at night (B) was fully compensated by an increased intake during daytime (C). Body weight (E–G): Thylakoids did not affect body weight (G), or body weight gain over time (F). Neither was there any difference between the groups regarding body weight gain per ingested energy (E). Visceral fat (H–I): Thylakoid treatment decreased visceral body fat mass (H) and BW percentage (I) compared with control. Group data are expressed as median and interquartile range for food intake and visceral fat, and as means ± SE for body weight (n = 8 rats/group). *P < 0.05, ***P < 0.001, ****P < 0.0001.
Body weight.
There were no differences in body weight between thylHFD and HFD control rats either on day 0 or day 14 (P = 0.63, Fig. 1G). Neither were there any differences between the groups in body weight gain over time (P = 0.81 Fig. 1F) nor total body weight gain per MJ (P = 0.81, Fig. 1E).
Adipose tissue: WAT and BAT.
Thylakoids decreased visceral fat pad weight (i.e., the intra-abdominal mesenteric, epididymal, and retroperitoneal fat pads) by 25% compared with control (P < 0.05, Fig. 1H). Thylakoids also decreased the percentage of visceral WAT per body weight compared with control (P < 0.05, Fig. 1I). The weight of inguinal subcutaneous WAT was not significantly different between the groups; the thylakoid group had 3.25 g of inguinal subcutaneous WAT (median, lower, and upper quartiles 3.05–3.67 g) and the control group had 3.71 g of inguinal subcutaneous WAT (lower and upper quartiles 2.87–4.59 g). Neither was there any significant difference between the weights of the interscapular BAT; the thylakoid group had 0.38 g interscapular BAT (median, lower, and upper quartiles 0.33–0.43 g), and the control group 0.37 g (lower and upper quartiles 0.36–0.43).
Intestinal fat oxidation genes.
All genes were normalized to Actb for analysis. Thylakoids induced a strong gene expression of Hmgcs2 (P < 0.05, Fig. 2E), Cpt1a (P < 0.05, Fig. 2F), and Fat/Cd36 (P < 0.05, Fig. 2I) in the jejunum compared with control. There was also a tendency toward increased expression of Lcad (P = 0.05, Fig. 2G), while the expression of Fabp2 (Fig. 2H) and Ppara (Fig. 2J) was not affected in the jejunum. No differences were seen in the duodenum (Fig. 2, A–D), the ileum (Fig. 2, K–N), or the liver (Fig. 2, O–T), except for a reduced expression of Ppara in the liver (P < 0.05, Fig. 2T).
Fig. 2.Thylakoids increased gene expression in the jejunum; however, duodenum, ileum, and liver were primarily unaffected. Duodenum (A–D): Thylakoids did not affect gene expression of fat metabolism-related genes in the duodenum compared with control (n = 5 control and 7 thylakoid rats). Jejunum (E–J): Thylakoids induced a strong expression of fat metabolism-related genes in the jejunum compared with control: Hmgcs2 (E), Cpt1a (F), and Fat/Cd36 (I). In addition, there was a tendency toward increased expression of Lcad (G), while Fabp2 (H) and Ppara (J) were not affected (n = 6 control and 7 thylakoid rats). Ileum (K–N): Thylakoids did not affect gene expression of fat metabolism-related genes in the ileum compared with control. (n = 4 control and 4 thylakoid rats). Liver (O–T): Thylakoids did not affect gene expression of fat metabolism-related genes in the liver compared with control, except for a reduced expression of Ppara (T) (n = 8 control and 8 thylakoid rats). Data are presented as fold change in gene expression and expressed as means ± SE. *P < 0.05.
Plasma metabolites.
Thylakoids did not affect levels of BHB, TG, or NEFA in plasma taken 70 min after the test meal (Table 2).
| Control Group Median (Lower-Upper Quartiles) | Thylakoid Group Median (Lower-Upper Quartiles) | |
|---|---|---|
| BHB, mmol/l | 0.16 (0.13–0.28) | 0.17 (0.04–0.24) |
| TG, mmol/l | 1.45 (1.40–1.75) | 1.65 (1.43–2.03) |
| NEFA, mmol/l | 0.22 (0.00–0.24) | 0.21 (0.00–0.21) |
Liver weights and CYP activity.
Thylakoids did not affect liver weights compared with controls. There were no differences in formation rate regarding either phenacetin-O-deetylation (CYP1A2), diclofenac-4′-hydroxylation (CYP2C9), bufuralol-1′-hydroxylation (CYP2D6), or midazolam-1′-hydroxylation (CYP3A4) (data not shown) between the thylakoid group and control group.
Second Experiment: Indirect Calorimetric Measures
Food intake.
Thylakoids decreased total caloric intake over the course of the study compared with control treatment (P < 0.01, total area under the curve, Fig. 3A). During 24 h, the thylHFD-fed rats consumed 371 kJ (median value) compared with the HFD-fed control rats that consumed 466 kJ (P < 0.01, Fig. 3B).
Fig. 3.Thylakoids decreased food intake, body weight gain, and body fat mass. Food intake (A and B): Thylakoids decreased food intake compared with control treatment. The graphs show average food intake per rat and day over time (A) and average food intake per rat during 24 h (B), data are expressed as median and interquartile range. Body weight gain (C–E): Thylakoids decreased body weight gain over time (E), reaching a significant difference in body weight between ThylHFD and HFD on day 12 (P = 0.01 and P < 0.001, two-way ANOVA followed by Bonferroni post hoc test). There were no significant differences between the groups in absolute body weight at any time point (D) or in body weight gain per ingested MJ (C). Group data are expressed as means ± SE. Body composition analysis (F): Thylakoids tended to decrease body fat mass compared with control treatment, but the difference did not reach statistical significance. Data are expressed as means ± SE (n = 10 rats/group). **P < 0.01, ***P < 0.001.
Body weight.
With ad libitum intake of thylHFD, thylakoids decreased body weight gain over time compared with the HFD-fed control group [effect of treatment: F (1, 18) = 7.2, P = 0.01, Fig. 3E]. On day 12, thylakoids had decreased body weight gain compared with controls by 17.5% ± 3.9 (P < 0.001, Fig. 3E). A significant interaction between time and treatment was found for absolute body weight [F (2, 36) = 6.0, P < 0.01, Fig. 3D], but no differences were found at any individual time point. Total body weight gain per MJ was not affected (Fig. 3C).
Body composition.
Thylakoids decreased total fat mass, as shown by the body composition analysis performed on day 14, even though this difference did not reach statistical significance (P = 0.10, Fig. 3F). There were no treatment differences in body fat percentage (Thylakoid Group: 3.6 ± 1.6 g, Control Group: 5.1 ± 2.4 g), total lean mass (Thylakoid Group: 317.4 ± 17.4 g, Control Group: 328.0 ± 19.7 g) or lean mass percentage (Thylakoid Group: 84.0 ± 2.6 g, Control Group: 83.9 ± 2.5 g).
Measurement of RQ.
Thylakoids decreased the RQ during the dark period compared with controls, 0.86 vs. 0.91 (P < 0.05, Fig. 4A), whereas no differences in RQ were found during the light period. When analyzed according to the relative cumulative frequency method (34), an overall decrease in RQ over the whole 48-h period was found in the Thylakoid Group compared with controls, 0.84 vs. 0.88 (P < 0.05, Fig. 4B). Analysis of the Hill slope coefficient revealed an increased adaptive metabolic capability to HFD feeding in the thylakoid-fed group, the Hill slope being steeper than in controls, i.e., 1.0 vs. 0.8 (P < 0.05, Fig. 4B). Thylakoids had no effect on whole body oxygen consumption during the indirect calorimetric measurements when normalized to absolute body weight or lean mass (data not shown). There were no differences in core body temperature (Fig. 5C) or activity levels (Fig. 5B) between the thylHFD and HFD rats. Finally, there were no differences either in the total energy expenditure over 48 h (Fig. 5A) or the total energy expenditure as a function of fat-free mass, where no differences in either the intercepts (P = 0.42) or the slopes (P = 0.25) were found (data not shown). Similarly, energy expenditure data for the dark hours were not significantly different between the groups (data not shown).
Fig. 4.Thylakoids decreased nighttime RQ. A: mean values during 48 h show a decrease in RQ in the Thylakoid Group during the dark hours (P < 0.05). B: frequency distribution of RQ values, presented as relative cumulative frequency. Statistical comparisons of the curves are based on the 50th percentile values, showing a decrease in the Thylakoid Group. In addition, the Hill slope for the thylakoid-treated group was steeper than in controls, indicating increased adaptive metabolic capability. Data are expressed as means (n = 10 rats/group). *P < 0.05.
Fig. 5.Thylakoids did not affect energy expenditure, activity levels, or body temperature. Energy expenditure (A): There was no difference between groups regarding total energy expenditure during the 48 h of indirect calorimetry. Activity levels (B): There were no significant differences in activity counts between the groups, measured during the indirect calorimetry. Body temperature (C): There were no differences between groups regarding core body temperature measured during the indirect calorimetry. Data are expressed as means ± SE (n = 10 rats/group).
Fecal fat analysis.
Thylakoids did not increase the fecal fat content compared with control. Analysis of fecal droppings collected during the 48 h of indirect calorimetry showed no difference in total fat content between thylakoid and control groups (P = 0.64, Fig. 6).
Fig. 6.Fecal fat analysis. The total fat content of the feces collected during the 48-h indirect calorimetry was not different between groups. Data are expressed as means ± SE, (n = 10 rats/group).
DISCUSSION
In this study, we report entirely novel findings, suggesting that daily intake of thylakoids together with a high-fat diet, increases intestinal fatty acid oxidation in the rat. The decreased RQ of rats consuming thylHFD indicates a shift in whole body substrate utilization toward an increase in fatty acid oxidation, which may start already in the intestinal enterocytes. The intestine, being a major metabolic organ accounting for ∼25% of total body oxygen consumption, requires a large amount of energy for enterocyte nutrient absorption (23, 41). As such, the intestine is able to use different sources of energy according to availability (23). Earlier studies have shown that when animals are fed a HFD, fatty acid oxidation and ketogenesis are induced (7, 20, 23, 40). This occurs through an increased activation of PPAR-α-dependent signaling in the intestine and liver, increasing the expression of enzymes that promote fatty acid oxidation, such as fatty acid translocase (FAT/CD36), fatty acid binding protein (FABP), and CPT1. PPAR-α also stimulates ketogenesis via HMG-CoAS2. Our findings suggest that adding thylakoids to a HFD further enhances these effects, helping the animals adapt to the increase in fatty acid substrate load. Analysis of the cumulative frequency distribution of the RQ and the Hill slope coefficient of the cumulative frequency distribution curves support this interpretation, indicating that thylakoid treatment enhances metabolic flexibility, i.e., the ability to switch between fuel sources depending on availability.
The decrease in RQ appeared during the dark period when animals are active, eat more, and normally tend to utilize more carbohydrates than fat (26). The increase in fat utilization over longer periods of time may, at least in part, explain the decrease in body weight and change in body composition seen both in the present study and in previous studies (11). The total energy expenditure was only measured for 48 h, which may not have been long enough to detect an increased energy expenditure representative for the whole 14-day experiment, corresponding to the reduced body weight gain that was found over the longer time span. It is important in this context that there was no fat loss via the feces, indicating that fat is, indeed, absorbed when thylakoids are present. This finding also supports previous studies stating that thylakoids prolong fat digestion reversibly (1, 8) and do not cause steatorrhea (30). One limitation to this study was that macronutrient oxidation could not be calculated since urinary nitrogen extraction was not measured (13).
Gene expression levels of the fatty acid oxidative enzymes Hmgcs2, Cpt1a, and Fat/Cd36 in the intestinal mucosa samples from the jejunum of rats were significantly higher in the thylakoid-treated group compared with the control group. There were, however, no differences in expression of Ppara in the intestine. These findings indicate that ingestion of thylHFD upregulated fatty acid oxidation and ketogenesis in enterocytes, but that this upregulation was not due to increased Ppara expression. Nevertheless, because all of the upregulated genes are normally regulated by PPAR-α-activity, there may still be a posttranscriptional activation of PPAR-α with dietary thylakoids in the intestine, thylakoids acting as a PPAR-α-agonist.
With PPAR-α being a key regulator of fatty acid uptake, activation of fatty acids and intracellular binding, mitochondrial, and peroxisomal fatty acid oxidation, ketogenesis, triglyceride turnover, and lipid droplet biology (19), the enzymes corresponding to the genes upregulated in this study are vital for different steps in fatty acid absorption and metabolism. FAT/CD36 is a key transporter of long-chain fatty acids across the cell plasma membrane into the enterocyte (4) and, therefore, important for the absorption of fatty acids. CPT1, a key regulatory enzyme of β-oxidation, catalyzes the rate-limiting step in the transport of activated fatty acids across the inner membrane of the mitochondria (3, 32), and HMGCS2 is the rate-limiting enzyme of ketogenesis (32). All of the observed changes in gene expression are, therefore, consistent with the interpretation that thylakoids enhanced the oxidation of diet-derived fatty acids in enterocytes, in particular, in the jejunum.
The hypothesis that thylakoids act as a ligand for PPAR-α is consistent with both the findings in the present study, as well as with earlier studies on thylakoids, demonstrating the lowering effects of thylakoids on blood lipid levels (1, 21, 22) and body fat accumulation (10, 22). An increase in intestinal fatty acid oxidation could also contribute to the reduced body weight and body fat in this study, as well as in earlier thylakoid studies in rodents (1, 10, 22) and humans (28). These findings are supported by the fact that there was no difference in fecal fat content between thylakoid-treated and control animals. mRNA translation is, however, regulated by many different factors. An upregulated gene expression, therefore, does not automatically translate into increased protein synthesis, and the effects of thylakoids on protein levels must be explored in future studies.
Karimian Azari et al. (17, 18), demonstrated that administration of the PPAR-α-agonists oleoyl ethanolamide or Wy-14643 stimulated fatty acid oxidation and ketogenesis, respectively, in the intestine and, in particular, in the jejunum, but not in the liver (17). Wy-14643 also caused an acute and transient decrease in RQ, and both compounds reduced food intake and increased hepatic portal vein BHB levels (18). These findings suggest that activation of PPAR-α may, indeed, lead to results similar to the ones found in the present study. In another study, an inhibition of diacylglycerol-O-acyltransferase and, hence, of the final step in triacylglycerol resynthesis in the enterocyte, also caused similar results, indicative of enhanced intestinal fatty acid oxidation and ketogenesis, and a shift toward whole body fat oxidation, as well as a decrease in food intake in rats fed a HFD (35), suggesting that any manipulation of intestinal fatty acid metabolism that may cause a shift in intestinal fat handling from reesterification to oxidation may cause similar effects.
With gene expression level changes indicating increased ketogenesis, one might expect increased levels of ketone bodies in plasma in the thylHFD-treated animals compared with the control animals. Dietary thylakoids did, however, not affect plasma levels of TG, NEFA, or ketone bodies at the selected time point. Nevertheless, this does not exclude a possible increase in ketogenesis and, in particular, in intestinal ketogenesis. Because the blood samples were taken more than 60 min after the test meal, there is the possibility that a peak in ketone body levels at an earlier time point was missed. In an earlier study, BHB levels peaked at 35 min and had already normalized at 60 min (17). Furthermore, in this earlier study, blood samples were taken from the hepatic portal vein, which might have yielded higher plasma levels of ketone bodies, if these were mainly produced in the intestine, compared with cardiac blood samples collected in the present study.
In the present study, we replicated previous results showing decreased body weight gain and body fat mass (9, 22), as well as reduced food intake (22, 30), in response to thylakoid treatment. Looking at food intake over time in the second experiment (Fig. 3A), HFD-fed animals ingested more than the thylHFD animals during the first 3 days, suggesting that the HFD was more palatable than the chow they switched from. There is no indication that the thylHFD was less palatable than the regular chow, because the food intake in the Thylakoid Group was stable over time (27). Had there been a palatability issue, the food intake would have been decreased during the first few days (2), which was not the case in this study nor in any previous studies with thylakoids in mice and rats (1, 9, 22, 30). In addition, palatability of thylakoids has been tested in conjunction with earlier studies and shown to have no appetite-suppressive effect (22). Therefore, we suggest that the reduced caloric intake in the thylakoid-fed animals, in spite of ad libitum access to food, may be explained by increased satiety due to enhanced fatty acid oxidation, which has been found associated with decreased food intake before (17, 23, 35). In previous studies with thylakoids, reduced food intake has been attributed to an increased release of satiation signals, such as CCK and GLP-1 (1, 21, 22, 28, 31, 39). Since appetite-regulating hormones were not analyzed in the present study, no conclusions can be drawn about the possible effect of satiety hormones in this study.
Thylakoids decreased body weight gain compared with controls in the second but not the first experiment. This may be due to the different feeding schedules. In the first experiment, the fixed amount of food at night may have limited the rats' total food consumption and, consequently, also attenuated their body weight gain (Fig. 1F), as opposed to ad libitum feeding during the whole 24 h in the second experiment (Fig. 3E). Seeing that the thylHFD-fed rats consumed the same daily amount of energy in both experiments (Figs. 1D and 3B), while the HFD-fed rats consumed more during the ad libitum condition (Fig. 3B), the Control Group was probably more affected by the night time restriction than the Thylakoid Group, which is reflected in the augmented body weight during the second experiment. This is confirmed by the fact that the thylakoid rats did not always finish the food given at night, while the control rats did. There were no differences in body weight gain per ingested MJ between groups in either experiment, suggesting that thylHFD does not increase energy expenditure compared with HFD, but changes the source utilized. Calculations of energy expenditure confirmed that there was indeed no difference between the groups. The calculation of energy expenditure was determined on the basis of V̇o2 and V̇co2 alone, which involves an error of about 4% in the fasting condition, however, decreasing with the metabolic rate (13).
Thylakoid treatment did not affect liver weights and CYP enzyme activity. Such an effect is important, considering that the number of patients being treated with multiple drugs continues to increase (16). Active components of fruits and vegetables can have inhibitory effects on CYP450 and drug metabolism, thereby causing serious adverse effects (25). Spinach juice has previously been reported to inhibit CYP1A2 in vitro and affect the metabolism of heterocyclic aromatic amines. Thylakoid treatment did not cause any differences in CYP activity compared with control animals for the CYPs examined in this study; however, the direct inhibitory effect of thylakoids remains to be addressed.
In conclusion, we found that compared with a control HFD, thylakoids together with a HFD in the rat stimulate intestinal fatty acid oxidation at the gene expression level—which has never been shown before—indicating that thylakoids may stimulate intestinal fatty acid oxidation by the upregulating of associated genes and, possibly, through activation of PPAR-α. The fact that thylakoids reduced the RQ during indirect calorimetry is also an entirely novel finding. Together with the fact that no difference in fecal fat was found, the increased fatty acid oxidation may contribute to the known effects of thylakoid treatment, such as body weight loss, reduced body fat, and blood lipids, as well as increased circulating levels of satiety hormones.
Perspectives and Significance
The present findings suggest that thylakoids are a promising natural additive that may be ingested for beneficial effects stimulating fat oxidation, starting already in the intestine. Further studies are necessary to examine whether the effect of thylakoids is, indeed, mediated through activation of PPAR-α.
GRANTS
The authors are grateful for the financial support from the Swedish Research Council, FORMAS, the Royal Physiographic Society in Lund and Runo Svensson Foundation. W. Langhans is supported by
DISCLOSURES
C. Erlanson-Albertsson is scientific advisor for Greenleaf Medical AB, as well as part owner and board member of Thylabisco AB.
AUTHOR CONTRIBUTIONS
E.-L.S., E.E., C.M., B.R.W., A.M., W.L., and C.E.-A. conception and design of research; E.-L.S., E.E., C.M., D.R., B.B., and B.R.W. performed experiments; E.-L.S., E.E., D.R., and B.B. analyzed data; E.-L.S., E.E., D.R., B.B., A.M., W.L., and C.E.-A. interpreted results of experiments; E.-L.S., E.E., and D.R. prepared figures; E.-L.S., E.E., D.R., and B.B. drafted manuscript; E.-L.S., E.E., C.M., D.R., B.B., B.R.W., A.M., W.L., and C.E.-A. edited and revised manuscript; E.-L.S., E.E., C.M., D.R., B.B., B.R.W., A.M., W.L., and C.E.-A. approved final version of manuscript.
ACKNOWLEDGMENTS
Greenleaf Medical AB, Stockholm, Sweden, donated the thylakoid extract. Michael Axelsson, Liudmyla Lozinska, and Agnieszka Czopek are thanked for valuable help with the analyses.
REFERENCES
- 1. . Chloroplast membranes retard fat digestion and induce satiety: effect of biological membranes on pancreatic lipase/co-lipase. Biochem J 401: 727–733, 2007.
Crossref | PubMed | Web of Science | Google Scholar - 2. . Behaviour components in the feeding of wild and laboratory rats. Behaviour 9: 24–43, 1956.
Crossref | Google Scholar - 3. . The mechanisms of action of PPARs. Annu Rev Med 53: 409–435, 2002.
Crossref | PubMed | Web of Science | Google Scholar - 4. . The fatty acid transporter FAT/CD36 is upregulated in subcutaneous and visceral adipose tissues in human obesity and type 2 diabetes. Int J Obes Rel Metab Disord 30: 877–883, 2006.
Crossref | Web of Science | Google Scholar - 5. . Dietary fat and obesity: a review of animal, clinical and epidemiological studies. Physiol Behav 83: 549–555, 2004.
Crossref | PubMed | Web of Science | Google Scholar - 6. . From fatty-acid sensing to chylomicron synthesis: role of intestinal lipid-binding proteins. Biochimie 96: 37–47, 2014.
Crossref | PubMed | Web of Science | Google Scholar - 7. . The role of the small intestine in the development of dietary fat-induced obesity and insulin resistance in C57BL/6J mice. BMC Med Genomics 1: 14, 2008.
Crossref | PubMed | Web of Science | Google Scholar - 8. . Pigments protect the light harvesting proteins of chloroplast thylakoid membranes against digestion by gastrointestinal proteases. Food Hydrocolloids 25: 1618–1626, 2011.
Crossref | Web of Science | Google Scholar - 9. . A large-scale method for preparation of plant thylakoids for use in body weight regulation. Prep Biochem Biotechnol 40: 13–27, 2010.
Crossref | PubMed | Web of Science | Google Scholar - 11. . The use of green leaf membranes to promote appetite control, suppress hedonic hunger and lose body weight. Plant Foods Hum Nutr 70: 281–290, 2015.
Crossref | PubMed | Web of Science | Google Scholar - 12. . Enzyme-structure relationships in the endoplasmic reticulum of rat liver: A morphological and biochemical study. J Cell Biol 15: 541–562, 1962.
Crossref | PubMed | Web of Science | Google Scholar - 13. . The theoretical bases of indirect calorimetry: a review. Metab Clin Exp 37: 287–301, 1988.
Crossref | PubMed | Web of Science | Google Scholar - 14. . A study of VitalView for behavioural and physiological monitoring in laboratory rats. Physiol Behav 77: 65–77, 2002.
Crossref | PubMed | Web of Science | Google Scholar - 15. . ABC of obesity. Obesity—time to wake up. Br Med J 333: 640–642, 2006.
Crossref | PubMed | Google Scholar - 16. . New era in drug interaction evaluation: U.S. Food and Drug Administration update on CYP enzymes, transporters, and the guidance process. J Clin Pharmacol 48: 662–670, 2008.
Crossref | PubMed | Web of Science | Google Scholar - 17. . Possible role of intestinal fatty acid oxidation in the eating-inhibitory effect of the PPAR-α agonist Wy-14643 in high-fat diet fed rats. PloS One 8: e74869, 2013.
Crossref | PubMed | Web of Science | Google Scholar - 18. . Vagal afferents are not necessary for the satiety effect of the gut lipid messenger oleoylethanolamide. Am J Physiol Regul Integr Comp Physiol 307: R167–R178, 2014.
Link | Web of Science | Google Scholar - 19. . Integrated physiology and systems biology of PPARα. Mol Metab 3: 354–371, 2014.
Crossref | PubMed | Web of Science | Google Scholar - 20. . Differential regulation of intestinal lipid metabolism-related genes in obesity-resistant A/J vs. obesity-prone C57BL/6J mice. Am J Physiol Endocrinol Metab 291: E1092–E1099, 2006.
Link | Web of Science | Google Scholar - 21. . Thylakoids promote release of the satiety hormone cholecystokinin while reducing insulin in healthy humans. Scand J Gastroenterol 44: 712–719, 2009.
Crossref | PubMed | Web of Science | Google Scholar - 22. . Thylakoids suppress appetite by increasing cholecystokinin resulting in lower food intake and body weight in high-fat fed mice. Phytother Res 23: 1778–1783, 2009.
Crossref | PubMed | Web of Science | Google Scholar - 23. . Dietary fat sensing via fatty acid oxidation in enterocytes: possible role in the control of eating. Am J Physiol Regul Integr Comp Physiol 300: R554–R565, 2011.
Link | Web of Science | Google Scholar - 24. . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408, 2001.
Crossref | PubMed | Web of Science | Google Scholar - 25. . Effect of fruit/vegetable-drug interactions on CYP450, OATP and p-glycoprotein: A systematic review. Trop J Pharm Res 14: 1927–1935, 2015.
Crossref | Web of Science | Google Scholar - 26. . Enhancing hepatic mitochondrial fatty acid oxidation stimulates eating in food-deprived mice. Am J Physiol Regul Integr Comp Physiol 308: R131–R137, 2015.
Link | Web of Science | Google Scholar - 27. . Food neophobia in wild and laboratory rats (multi-strain comparison). Behav Proc 113: 41–50, 2015.
Crossref | PubMed | Web of Science | Google Scholar - 28. . Body weight loss, reduced urge for palatable food and increased release of GLP-1 through daily supplementation with green-plant membranes for three months in overweight women. Appetite 81: 295–304, 2014.
Crossref | PubMed | Web of Science | Google Scholar - 29. . Chloroplast thylakoids reduce glucose uptake and decrease intestinal macromolecular permeability. Br J Nutr 106: 836–844, 2011.
Crossref | PubMed | Web of Science | Google Scholar - 30. . Feeding spinach thylakoids to rats modulates the gut microbiota, decreases food intake and affects the insulin response. J Nutr Sci 2: e20, 2013.
Crossref | PubMed | Google Scholar - 31. . Dietary thylakoids suppress blood glucose and modulate appetite-regulating hormones in pigs exposed to oral glucose tolerance test. Clin Nutr 33: 1122–1126, 2014.
Crossref | PubMed | Web of Science | Google Scholar - 32. . Regulation of energy metabolism by long-chain fatty acids. Prog Lipid Res 53: 124–144, 2014.
Crossref | PubMed | Web of Science | Google Scholar - 33. . Acute effects of a spinach extract rich in thylakoids on satiety: A randomized controlled crossover trial. J Am Coll Nutr 34: 470–477, 2015.
Crossref | PubMed | Web of Science | Google Scholar - 34. . Percent relative cumulative frequency analysis in indirect calorimetry: application to studies of transgenic mice. Can J Physiol Pharmacol 82: 1075–1083, 2004.
Crossref | PubMed | Web of Science | Google Scholar - 35. . Diacylglycerol acyltransferase-1 inhibition enhances intestinal fatty acid oxidation and reduces energy intake in rats. J Lipid Res 54: 1369–1384, 2013.
Crossref | PubMed | Web of Science | Google Scholar - 36. . A cocktail approach for assessing the in vitro activity of human cytochrome P450s: an overview of current methodologies. J Pharm Biomed Anal 101: 221–237, 2014.
Crossref | PubMed | Web of Science | Google Scholar - 37. . Consumption of thylakoid-rich spinach extract reduces hunger, increases satiety and reduces cravings for palatable food in overweight women. Appetite 91: 209–219, 2015.
Crossref | PubMed | Web of Science | Google Scholar - 38. . Decreased urge for palatable food after a two-month dietary intervention with green-plant membranes in overweight women. J Obes Weight Loss Ther 4: 238, 2014.
Google Scholar - 39. . Supplementation by thylakoids to a high carbohydrate meal decreases feelings of hunger, elevates CCK levels and prevents postprandial hypoglycaemia in overweight women. Appetite 68: 118–123, 2013.
Crossref | PubMed | Web of Science | Google Scholar - 40. . Developmental changes in mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene expression in rat liver, intestine and kidney. Biochem J 292: 493–496, 1993.
Crossref | PubMed | Web of Science | Google Scholar - 41. . The intestinal fatty acid binding protein is not essential for dietary fat absorption in mice. FASEB J 14: 2040–2046, 2000.
Crossref | PubMed | Web of Science | Google Scholar - 42. . New methods for calculating metabolic rate with special reference to protein metabolism. J Physiol 109: 1–9, 1949.
Crossref | PubMed | Web of Science | Google Scholar - 43.
WHO . Healthy diet. Factsheet no. 394, http://whoint/mediacentre/factsheets/fs394/en/ (accessed 2016-02-19).
Google Scholar
