Statin reverses reduction of adiponectin receptor expression in infarcted heart and in TNF-α-treated cardiomyocytes in association with improved glucose uptake
Abstract
Statin treatment improves insulin resistance in skeletal muscle. Thus this study assessed whether statin may affect the myocardial expression levels of AdipoR1 and AdipoR2, receptors of adiponectin that enhance insulin sensitivity, and whether statin may improve insulin resistance in cardiomyocytes. Myocardial infarction (MI) was created by the ligation of the left coronary artery in male mice. Expression levels of mRNA and protein levels of AdipoR1 but not of AdipoR2 were significantly decreased in the remote area as well as in the healed infarcted area in the left ventricles 4 wk after MI. Oral administration of pravastatin (50 mg·kg−1·day−1 for 4 wk after MI) reversed the decrease in myocardial expression levels of AdipoR1 independently of changes in serum lipid profiles and insulin levels. With the use of cultured cardiomyocytes, incubation with tumor necrosis factor (TNF)-α, a mediator of postinfarction myocardial dysfunction, inhibited AdipoR1 mRNA and protein expression levels. Coincubation of the cells with pravastatin reversed the inhibitory effects of TNF-α on AdipoR1 expression. In parallel, pravastatin reversed the TNF-α-induced decrease in globular adiponectin-induced 2-deoxy-d-[3H]glucose uptake in insulin-treated cultured cells. Moreover, this effect of pravastatin was inhibited by the suppression of AdipoR1 expression by small-interfering RNA specific for AdipoR1. Incubation with H2O2 reduced AdipoR1 expression in cultured cardiomyocytes that were attenuated by N-acetyl-l-cysteine or pravastatin. Pravastatin suppressed TNF-α-induced intracellular oxidants in cultured cardiomyocytes. In conclusion, pravastatin reversed the reduction of AdipoR1 expression in postinfarction mouse myocardium and in TNF-α-treated cardiomyocytes partly through an antioxidative mechanism in association with improved glucose uptake.
over the past several years, many pleiotropic effects of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins) have been identified (10, 25). Statins improve the prognosis of heart diseases via an improvement of endothelial function and suppression of inflammatory responses in addition to lipid-lowering effects (1, 18). To date, there is compelling evidence that an impaired energy metabolism in cardiomyocytes strongly influences ventricular remodeling (13, 20). It is also known that abnormalities in glucose and lipid metabolism in cardiac muscle are associated with heart failure (5, 15). It is thus possible that drugs that improve myocardial metabolic abnormalities might be useful in preventing the progression of heart failure. Recently, it was shown that atorvastatin exerts a favorable effect on insulin sensitivity of skeletal muscle in diabetic animals (26). Therefore, it is expected that statins may improve insulin sensitivity in the myocardium of the failing heart.
Adiponectin, the most abundant protein secreted from adipose tissue, has antiatherogenic, anti-inflammatory, and antidiabetic effects (3, 4, 9, 12, 22, 24). Furthermore, circulating levels of adiponectin are lower in coronary artery disease (CAD) and predict future cardiovascular events (17). Adiponectin plays a fundamental role in glucose and lipid metabolism in adipose tissue and has insulin-sensitizing effects on the liver and skeletal muscle (4, 9, 12). Two novel adiponectin receptor types (AdipoR1 and AdipoR2) were recently identified (27). In skeletal muscle, adiponectin increases glucose uptake and fatty acid oxidation through stimulation of these receptors (9, 27). We have also demonstrated that myocardium expresses AdipoR1 and AdipoR2 and that AdipoR1 and AdipoR2 might play a possible role in the pathogenesis of endothelin-1-induced hypertrophy of cardiomyocytes after myocardial infarction (MI) (6). Thus, this study assessed the hypothesis that statin treatment may increase the expression of AdipoR1 and/or AdipoR2 in postinfarction myocardium, leading to an improvement of myocardial insulin resistance.
METHODS
Materials.
Pravastatin was a gift from Sankyo (Tokyo, Japan). Rat recombinant globular adiponectin (glb-adiponectin) was purchased from Adipogen (Sungnam, Korea). Anti-AdipoR1 polyclonal antibody was purchased from Affinity BioReagents (Colden, CO), and anti-AdipoR2 polyclonal antibody was purchased from Alpha Diagnostic International (San Antonio, TX). Anti-β-tubulin polyclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). Cell culture reagents were from Sigma (Tokyo, Japan) and Invitrogen (Carlsbad, CA). Fetal bovine serum (FBS) and 2′,7′-dichlorodihydrofluorescein diacetate (DCF-DA) were from Invitrogen. 2-Deoxy-d-[3H]glucose was from Moravek Biochemicals (Brea, CA). [1-14C]palmitic acid was from Perkin Elmer (Boston, MA). Rat recombinant tumor necrosis factor (TNF)-α was from BioVision Research Products (Mountain View, CA). Insulin and other chemicals were purchased from Sigma.
Animal models of MI.
The experimental protocol was approved by the University of Yamanashi Animal Care and Use Committee, and all procedures were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (1996). MI in 8- to 12-wk-old male mice was created by ligation of the left coronary artery under anesthesia with pentobarbital sodium (50 mg/kg ip) and ventilated with a respirator (6). The chest was then closed with 7-0 polypropylene sutures. On day 1 after MI, mice were randomized to treatment with pravastatin (50 mg·kg−1·day−1) or vehicle by gavage for 4 wk. Only mice with extensive MI (>30%) were analyzed for the measurement of mRNA and protein expression levels. Sham-operated mice served as controls. Finally, the mice were euthanized and harvested 4 wk after the surgery. Parts of the tissue samples from the left ventricle were quickly frozen and stored at −80°C until use for the measurement of mRNA and protein expression levels. Blood was collected by intracardiac puncture just before euthanasia under anesthesia. Serum levels of total cholesterol, triglyceride, and glucose were determined by enzymatic assays according to the protocols of the manufacturers (Wako and Sigma, Osaka, Japan). Fasting serum insulin levels were determined by an enzyme immunoassay (Mercodia, Sweden).
Preparation and culture of cardiomyocytes.
Primary cultures of rat neonatal cardiomyocytes were prepared by trypsin/EDTA digestion from the ventricles of 1- to 3-day-old Sprague-Dawley rats, as described previously (6). Briefly, after trypsinization, the cells were collected by centrifugation and diluted to 5 × 106 cells/ml in DMEM containing 10% FBS. The cells were preplated and cultured for 30 min to delete the nonmyocardial cells. Nonattached cells were suspended in DMEM containing 10% FBS and plated for 72 h on plastic petri dishes of the indicated sizes. After cells were washed, they were replaced with DMEM containing 0.5% FBS for 24 h before each experiment. For measurement of mRNA and protein expression levels, the cultured cells were treated for 12 or 24 h with TNF-α (10 ng/ml), norepinephrine (100 nM), H2O2 (10 μM), or the vehicle in the presence or absence of pravastatin (1–10 μM) or N-acetyl-lcysteine (NAC; 1 mM).
Measurements of mRNA and protein expression levels in myocardial tissues and cultured cardiomyocytes.
Total RNA was extracted from myocardial tissues or cultured cardiomyocytes with a Qiagen RNeasy kit and DNase I (Qiagen). The expression levels of mRNA for AdipoR1 and AdipoR2 were quantified by a real-time two-step reverse transcriptase (PE Applied Biosystems, Foster City, CA) PCR assay using SYBRgreen chemistry (Applied Biosystems) based on the 5′ nuclease activity of Taq DNA polymerase and with the use of a GeneAmp 7500 Sequence Detection System (Applied Biosystems) (6). The PCR primers are listed in Table 1. The GAPDH housekeeping gene was used for normalization of target gene expression.
| Primers | Sequences |
|---|---|
| Real-time PCR | |
| mouse AdipoR1 forward | 5′-ACGTTGGAGAGTCATCCCGTAT-3′ |
| mouse AdipoR1 reverse | 5′-CTCTGTGTGGATGCGGAAGAT-3′ |
| mouse AdipoR2 forward | 5′-TCCCAGGAAGATGAAGGGTTTAT-3′ |
| mouse AdipoR2 reverse | 5′-TTCCATTCGTTCCATAGCATGA-3′ |
| rat AdipoR1 forward | 5′-TCTTCCTCATGGCTGTGATG-3′ |
| rat AdipoR1 reverse | 5′-AGCACTTGGGAAGTTCCTCC-3′ |
| rat AdipoR2 forward | 5′-GGAGCCATTCTCTGCCTTTC-3′ |
| rat AdipoR2 reverse | 5′-ACCAGATGTCACATTTGCCA-3′ |
| siRNA | |
| rat AdipoR1 siRNA | UACAACACCACUCAAGCCAAGUCCC |
| rat AdipoR2 siRNA | AACAGGUGUCUCUAAACUGGGCUCC |
| rat unrelated siRNA | AUUUAACUUCUGGUGACGAUACUGG |
For immunoblot analysis, extracts of myocardial tissue (30 μg) or treated cells (15 μg) were matched for protein concentration with an SDS-PAGE sample buffer. These samples were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membranes were incubated with the indicated primary antibodies overnight at 4°C, followed by incubation with a secondary antibody conjugated with horseradish peroxidase at a 1:10,000 dilution. The ECL Plus Western Blotting Detection System (Amersham Biosciences, Piscataway, NJ) was used for detection. The intensity of the β-tubulin band was used as a loading control between samples.
Measurement of glucose uptake in cultured cardiomyocytes.
Glucose uptake in cultured cardiomyocytes was evaluated by incorporation of 2-deoxy-d-[3H]glucose into the cells (27). The cultured cells in 24-well plates (4.0 × 105 cells/well) were incubated for 24 h with TNF-α (10 ng/ml) or the vehicle in the presence or absence of pravastatin (10 μM) in DMEM medium containing 0.5% FBS. After cells were washed twice with cold PBS, they were incubated for 30 min with or without glb-adiponectin (0.25 μg/ml) in glucose-free DMEM medium containing 0.1% fatty acid free bovine serum albumin. After subsequent incubation with insulin (10 nM) for an additional 30 min, glucose uptake was initiated by the addition of 2-deoxy-d-[3H]glucose to a final assay concentration of 3 μCi/ml for 10 min at 37°C. Reactions were terminated by rapidly washing the cells twice with cold PBS. Cardiomyocytes were solubilized in 1 N NaOH and neutralized with 1 N HCl, and the radioactivity in aliquots from cell extracts was counted by liquid scintillation (MicroScint20, TopCount, Packard Instrument, Meriden, CT). Protein assay of the cell extracts was performed with 10 μl of the lysate by use of a BCA protein assay kit (Pierce Chemical, Rockford, IL). Deoxyglucose uptake was expressed as counts per minute per milligram of protein and normalized to vehicle-treated cells.
Measurement of fatty acid oxidation in cultured cardiomyocytes.
Experiments for fatty acid oxidation were performed with modifications to the methods described by Yamauchi et al. (28). Cardiomyocytes were allowed to attach to 60-mm center-well organ culture dishes. The attached cells were incubated for 24 h with TNF-α (10 ng/ml) or the vehicle in the presence or absence of pravastatin (10 μM) in DMEM medium containing 0.5% FBS. Subsequently, the cells were preincubated for 6 h with or without glb-adiponectin (0.25 μg/ml). After cells were washed twice with cold PBS, they were incubated with DMEM containing 0.05 mM palmitic acid, 3% fatty acid free bovine serum albumin, and 5 mM glucose with or without glb-adiponectin (0.25 μg/ml) for 30 min at 37°C. [1-14C]palmitic acid (0.5 μCi) was then added, and the incubation was continued for an additional 30 min to reach a steady-state situation. Thereafter, 500 ml of 0.1 N NaOH were then injected into the center wells of the dishes, and the dishes were subsequently sealed airtight. The oxidation was terminated by injecting 400 μl of 1 M H2SO4 into the incubation buffer at 30 min after the addition of NaOH. The dishes were stored at 4°C overnight. The trapping medium (NaOH) was then assessed for 14CO2 by liquid scintillation counting (Opti-Fluor, Perkin Elmer; and LSC-5100, Aloka, Tokyo, Japan). The oxidation rate was calculated by subtracting trapped 14CO2 at zero time from trapped 14CO2 after 30 min of incubation and was expressed as counts per minute per milligram of protein and normalized to vehicle-treated cells.
RNA interference and transfection.
Small-interfering RNAs (siRNAs) were designed and synthesized by Invitrogen, as described in a previous report from Kugiyama's laboratory (6). The sequences of the sense siRNAs are listed in Table 1. The cultured cardiomyocytes were transfected with 100 nM of siRNAs by using Lipofectamine 2000 (6). After cardiomyocytes were washed, the medium was replaced with DMEM medium containing 0.5% FBS for 12 h. The cells were then assayed for glucose uptake.
Assessment of intracellular oxidants production in cultured cardiomyocytes.
Intracellular reactive oxygen species (ROS) production was measured using DCF-DA (5). The cultured cardiomyocytes in 12 wells (3 × 105 cells/well) were treated for 6 h with TNF-α (10 ng/ml) or the vehicle in the presence or absence of pravastatin (1–10 μM), mevalonate (100 μM), NAC (1 mM), or glb-adiponectin (0.25 μg/ml) in DMEM containing 0.5% FBS. After being washed with PBS, the cells were subsequently loaded with DCF-DA (10 μmol/l) in PBS at 37°C for 30 min and then washed twice with PBS to remove the excess probe. Dichlorofluorescein (DCF) fluorescence intensity was immediately measured in a plate reader (Gemini EM, Molecular Devices, Sunnyvale, CA) with an excitation/emission wavelength of 495/525 nm. DCF values were calculated after subtracting background fluorescence levels (measured under identical conditions but without DCF) and expressed as values per milligram of protein. Fluorescence intensity was normalized to the vehicle-treated cells. In parallel, fluorescence images of the cultured cells were obtained from three or more randomly chosen fields using an inverted epifluorescence microscope (IX70; Olympus, Tokyo, Japan) with a 470–490 nm excitation and 515–550 nm emission filter (IX-FLA; Olympus). The microscope was equipped with a computer-controlled VB-7000 charged-coupled device camera and VB-Viewer image capture software (Keyence, Osaka, Japan).
Statistical analysis.
Results are expressed as means ± SE. Mean values were compared between two groups using an unpaired t-test. Comparisons among three or more groups were performed by one-way ANOVA with the Tukey's test procedure used for post hoc comparisons of group means. P < 0.05 was considered statistically significant.
RESULTS
Effects of pravastatin treatment on expressions of AdipoR1 and AdipoR2 in hearts after MI.
When compared with the normal left ventricle, expression levels of AdipoR1 mRNA and protein were decreased in the remote area as well as in the infarcted area 4 wk after MI in mice (Fig. 1). AdipoR2 expression levels had a tendency to decrease in both areas, but they did not reach statistical significance (Fig. 1). Oral administration of pravastatin attenuated the decrease in expression levels of AdipoR1 mRNA and protein in the remote area 4 wk after MI (Fig. 1). Expression levels of AdipoR2 mRNA and protein were not significantly changed by pravastatin treatment.

Fig. 1.mRNA and protein expression of adiponectin receptors 1 and 2 (AdipoR1 and AdipoR2, respectively) in the left ventricle 4 wk after myocardial infarction (MI). A: real-time quantitative PCR analysis of AdipoR1 (left) and AdipoR2 (right) mRNA expression in the remote (top) and the infarcted (bottom) areas of the left ventricle 4 wk after MI in mice. Oral pravastatin (Prava; 50 mg·kg−1·day−1) or vehicle was administered during 4 wk after MI. Sham-operated mice served as a control group. The levels of mRNA expression were normalized to GAPDH mRNA expression and expressed relative to those of the sham-operated ventricle. Values are expressed as means ± SE (n = 9 in each experiment). Insets show representative agarose gel electrophoresis of the amplified PCR products from 0.1 μg of total RNA (AdipoR1 and GAPDH at 23 cycles and AdipoR2 at 30 cycles). B: immunoblot analysis using antibodies against AdipoR1 (left) and AdipoR2 (right) protein expression in the remote area (top) and the infarcted area (bottom) and in the sham-operated ventricle. The intensity of the β-tubulin band was used as a loading control between samples. The protein levels are expressed relative to those of the sham-operated ventricle. Values are expressed as means ± SE (n = 9–15). *P < 0.05. NS, not significant.
Effect of pravastatin treatment on serum lipid, glucose, and insulin levels in mice.
Pravastatin treatment for 4 wk had no effect on fasting serum levels of total cholesterol, triglycerides, glucose, and insulin, as shown in Table 2.
| Sham | MI + Vehicle | MI + Pravastatin | |
|---|---|---|---|
| Total cholesterol, mg/dl | 98.7±3.1 | 94.3±2.8 | 95.9±4.9 |
| Triglyceride, mg/dl | 68.5±6.5 | 96.4±6.5 | 92.6±8.8 |
| Glucose, mg/dl | 111.5±7.9 | 137.0±10.6 | 111.4±13.9 |
| Insulin, ng/ml | 1.47±0.43 | 1.05±0.23 | 0.93±0.19 |
Effect of pravastatin on AdipoR1 expression in cultured cardiomyocytes.
We previously reported that both TNF-α and norepinephrine inhibited mRNA expression levels of AdipoR1 in cultured cardiomyocytes (6). Thus we examined the effects of pravastatin on TNF-α- or norepinephrine-induced inhibition of AdipoR1 expression in cultured cardiomyocytes in the present study. Incubation with TNF-α or norepinephrine significantly inhibited expression levels of AdipoR1 mRNA and protein in cultured cardiomyocytes that was reversed by coincubation with pravastatin (1–10 μM) (Fig. 2). The effect of pravastatin to reverse TNF-α-induced inhibition of AdipoR1 expression was attenuated by coincubation with mevalonate (200 μM) (Fig. 3A). NAC also reversed TNF-α-induced inhibition of AdipoR1 expression (Fig. 3A). Incubation with H2O2 inhibited AdipoR1 mRNA expression that was also reversed by coincubation with pravastatin or NAC (Fig. 3B).

Fig. 2.Expression of AdipoR1 in cultured cardiomyocytes. A: real-time quantitative PCR analysis of AdipoR1 mRNA expression in neonatal-cultured cardiomyocytes after incubation for 12 h with TNF-α (10 ng/ml), norepinephrine (Norepi; 100 nM), or vehicle in the presence or absence of Prava. The levels of mRNA expression were normalized to GAPDH mRNA expression and expressed relative to the vehicle-treated cells. Values are expressed as means ± SE (n = 6 in each experiment). Insets show representative agarose gel electrophoresis of the amplified PCR products (23 cycles) from 0.1 μg of total RNA. B: immunoblot analysis using antibodies against AdipoR1 protein expression in cultured cardiomyocytes after incubation for 24 h with TNF-α (10 ng/ml), Norepi (100 nM), or vehicle in the presence or absence of Prava. The intensity of the β-tubulin band was used as a loading control between samples. The protein levels are expressed relative to the vehicle-treated cells. Values are expressed as means ± SE (n = 8–11 in each experiment). *P < 0.05.

Fig. 3.Effects of TNF-α (A), H2O2 (B), and N-acetyl-l-cysteine (NAC) on mRNA expression of AdipoR1 in cultured cardiomyocytes. Real-time quantitative PCR analysis of AdipoR1 mRNA expression in the treated cultured cardiomyocytes. The levels of mRNA expression were normalized to GAPDH mRNA expression and expressed relative to the vehicle-treated cells. Values are expressed as means ± SE (n = 6 in each experiment). *P < 0.05. Insets show representative agarose gel electrophoresis of the amplified PCR products (23 cycles) from 0.1 μg of total RNA [10 ng/ml TNF-α, 10 μM H2O2, 200 μM mevalonate (Meva)].
Role of adiponectin and AdipoR1 in glucose uptake and fatty acid oxidation of cultured cardiomyocytes.
Insulin increased 2-deoxy-d-[3H]glucose uptake in cultured cardiomyocytes (Fig. 4A). Glb-adiponectin further increased insulin-stimulated glucose uptake in cultured cardiomyocytes (Fig. 4A). Pravastatin alone did not affect insulin-stimulated glucose uptake. Coincubation with TNF-α reduced the glb-adiponectin-induced increase in the glucose uptake. Coincubation with pravastatin reversed the reduction in the glb-adiponectin-induced increase in the glucose uptake in the presence of TNF-α (Fig. 4A). Transfection of siRNA specific for AdipoR1 attenuated the ability of pravastatin to reverse the TNF-α-induced reduction of the glucose uptake, whereas siRNA specific for AdipoR2 had no significant effect (Fig. 4A). In parallel, coincubation with pravastatin reversed the reduction in glb-adiponectin-induced increase in the fatty acid oxidation in the presence of TNF-α, which was reversed by transfection of siRNA for AdipoR1 (Fig. 4B). The transfection of these siRNAs suppressed protein expression levels of the respective AdipoR1 and AdipoR2 (Table 3).

Fig. 4.Glucose uptake and fatty acid oxidation in cultured cardiomyocytes. A: glucose uptake in cultured cardiomyocytes was evaluated by incorporation of 2-deoxy-d-[3H]glucose into the cells. Deoxyglucose uptake is expressed as counts per minute per milligram of protein and is normalized to values in vehicle-treated cells. Values are expressed as means ± SE (n = 9–12 in each experiment). B: fatty acid oxidation in cultured cardiomyocytes was measured by the production of 14CO2 from [1-14C]palmitate. 14CO2 production is expressed as counts per minute per milligram of protein and is normalized to values in vehicle-treated cells. Values are expressed as means ± SE (n = 7–10 in each experiment). siRNA, small-interfering RNA; glb-adiponectin, globular adiponectin. *P < 0.05.
Effects of pravastatin on intracellular ROS production in cultured cardiomyocytes.
Incubation of cultured cardiomyocytes with TNF-α increased DCF fluorescence intensity, which was reversed by coincubation with pravastatin or NAC (Figs. 5 and 6). Glb-adiponectin (0.25 μg/ml) had no effect. Coincubation with mevalonate attenuated the ability of pravastatin to reverse the TNF-α-induced increase in DCF fluorescence intensity (Figs. 5 and 6).

Fig. 5.Intracellular reactive oxygen species (ROS) in cultured cardiomyocytes. Intracellular ROS production was measured using the 2′,7′-dichlorodihydrofluorescein diacetate assay. The cultured cardiomyocytes in 12 wells (3.0 × 105 cells/well) were treated for 6 h with TNF-α (10 ng/ml) or vehicle in the presence or absence of Prava (1–10 μM), Meva (100 μM), NAC (1 mM), or glb-adiponectin (0.25 μg/ml). Dichlorofluorescein (DCF) fluorescence intensity was measured in a plate reader with an excitation/emission wavelength of 495/525 nm. DCF fluorescence intensity is expressed as counts per milligram of protein and was normalized to the values in vehicle-treated cells. Values are expressed as means ± SE (n = 10–15 in each experiment). *P < 0.05.

Fig. 6.DCF fluorescence images of cultured cardiomyocytes. Representative images are shown from 3 independent experiments. Vehicle (A), TNF-α (10 ng/ml; B), TNF-α + Prava (1 μM; C), TNF-α + Prava (10 μM; D), TNF-α + Prava (10 μM) + Meva (100 μM) (E), and TNF-α + NAC (1 mM; F) are shown.
DISCUSSION
The present study demonstrated that AdipoR1 expression levels were decreased in the remote as well as the infarcted area of the left ventricle after MI and that oral administration of pravastatin reversed the decrease in AdipoR1 expression levels in the remote area independently of changes in serum cholesterol and insulin levels. Furthermore, with the use of cultured cardiomyocytes, coincubation with pravastatin also reversed the suppression of AdipoR1 expression after incubation with TNF-α or norepinephrine, potential mediators of postinfarction ventricular remodeling and dysfunction. Moreover, the present study showed that pravastatin reversed the reduction in the glb-adiponectin-induced increase in glucose uptake in the presence of TNF-α in cultured cardiomyocytes. The reversal by pravastatin of TNF-α-induced suppression of AdipoR1 expression might account for the improvement of glucose uptake, because inhibition of AdipoR1 expression with siRNA attenuated the effect of pravastatin. Therefore, it is possible that pravastatin treatment might reverse the suppression of AdipoR1 expression in the infarcted heart, leading to improvement of glucose metabolism.
The present study showed that incubation with H2O2 suppressed AdipoR1 expression in cultured cardiomyocytes. Moreover, the suppression of AdipoR1 expression after incubation with TNF-α was reversed by NAC, a potent antioxidant. Pravastatin inhibited the TNF-α-induced production of intracellular ROS in cultured cardiomyocytes. Taken together, these results indicate that TNF-α suppressed AdipoR1 expression in cardiomyocytes at least partly through a mechanism of oxidative stress and that an antioxidative effect of pravastatin accounted for the attenuation of TNF-α-induced suppression of AdipoR1 expression. It is likely that the antioxidative effect of pravastatin depends on HMG-CoA reductase inhibition, because of the inhibitory effect of coincubation with mevalonate. This effect may be mediated by downstream isoprenoids in the mevalonate cholesterol pathway (i.e., geranylgeranylpyrophosphate, farnesylpyrophosphate, and squalene), as suggested in previous reports (25). AdipoR1 expression in cultured cardiomyocytes was not changed by incubation with pravastatin at lower concentrations of pravastatin (<1 μM) similar to the serum concentrations in humans or in mice (data not shown). In consideration of the fact that mice were treated with pravastatin over a period of 4 wk, this exposure time was much longer compared with the in vitro experiment where the cultured cardiomyocytes were treated with pravastatin only for 12–24 h. However, it was impossible to prolong the incubation time for 4 wk in the present in vitro experiment.
It is known that myocardial insulin resistance is associated with myocardial dysfunction (5, 13, 15, 20). A recent experimental study (29) demonstrated that the restoration of myocardial insulin sensitivity in the failing heart protects from myocardial ischemia-reperfusion injury and improves myocardial function. Thus myocardial insulin resistance may be a target for the treatment of ischemic heart disease and heart failure (21). In this context, it is expected that a drug that increases myocardial expression of AdipoR1 could possibly improve myocardial insulin sensitivity and may be useful in the treatment of ischemic heart disease and heart failure (9).
It is known that oxidative stress and TNF-α are pathologically linked together with both insulin resistance and postinfarction myocardial dysfunction (2, 4, 24). Furthermore, several reports (2–4, 9, 12) have shown that oxidative stress and TNF-α counteract the insulin-sensitizing effect of adiponectin in adipose tissue. Moreover, it has been shown that oxidative stress suppresses adiponectin production and that adiponectin in turn exerts an antioxidative effect (7, 8, 23, 28). Therefore, adiponectin and its receptor system may have an important protective role against oxidative stress- or TNF-α-mediated myocardial insulin resistance and dysfunction after MI.
It is has been reported that adiponectin has protective actions against TNF-α-mediated myocardial injury and apoptosis in animal models of MI (19). We have previously shown that statin treatment increases circulating levels of adiponectin in patients with CAD in association with an improvement of endothelial function and the homoeostasis model assessment for insulin resistance, a parameter of whole body insulin sensitivity (14). The present study showed that pravastatin reversed TNF-α-induced reduction in fatty acid oxidation as well as glucose uptake, both of which are essential for maintaining cardiac function (20). Therefore, the increase in myocardial AdipoR1 expression and circulating adiponectin levels may represent an important and additional mechanism for the beneficial effects of statins in ischemic heart disease and heart failure. However, it is known that the high rate of fatty acid oxidation suppresses glucose oxidation in the heart (20). In agreement with this effect, a recent study (16) showed that adiponectin had time-dependent effects on glucose metabolism in cultured neonatal rat cardiomyocytes, i.e., the initial increase and subsequent suppression after a 48-h incubation with adiponectin, which were accompanied by the increase in fatty acid oxidation. Although the long-term consequences of alteration of myocardial substrate selection in chronic ischemic heart disease are poorly understood, further studies are required for clarification of the possible role of the adiponectin-induced alteration of myocardial substrate selection in the pathophysiology of ischemic heart disease. Serum levels of glb-adiponectin are <1% of the total adiponectin levels (10–30 μg/ml), according to a previous study (11). Therefore, the dose (0.25 μg/ml) of glb-adiponectin used in the present study seems to be the same range of the serum concentrations.
In conclusion, pravastatin reversed the reduction of AdipoR1 expression in postinfarction mouse myocardium and in TNF-α-treated cardiomyocytes partly through an antioxidative mechanism in association with improvement of glucose uptake.
GRANTS
This study was supported by Grants-in-Aid (B)(2)-15390244 and Priority Areas C for Medical Genome Science 15012222 from the Ministry of Education, Culture, Sports, Science, and Technology, Health and Labor Sciences Research Grants for Comprehensive Research on Aging and Health (H15-Choju-012), Tokyo, Japan.
FOOTNOTES
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We gratefully acknowledge the technical assistance of M. Hayashi and A. Watanabe.
REFERENCES
- 1 Bonetti PO, Lerman LO, Napoli C, Lerman A. Statin effects beyond lipid lowering—are they clinically relevant? Eur Heart J 24: 225–248, 2003.
Crossref | PubMed | ISI | Google Scholar - 2 Dandona P, Aljada A, Bandyopadhyay A. Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol 25: 4–7, 2004.
Crossref | PubMed | ISI | Google Scholar - 3 Diez JJ, Iglesias P. The role of the novel adipocyte-derived hormone adiponectin in human disease. Eur J Endocrinol 148: 293–300, 2003.
Crossref | PubMed | ISI | Google Scholar - 4 Fasshauer M, Paschke R. Regulation of adipocytokines and insulin resistance. Diabetologia 46: 1594–1603, 2003.
Crossref | PubMed | ISI | Google Scholar - 5 Finck BN, Han X, Courtois M, Aimond F, Nerbonne JM, Kovacs A, Gross RW, Kelly DP. A critical role for PPARalpha-mediated lipotoxicity in the pathogenesis of diabetic cardiomyopathy: modulation by dietary fat content. Proc Natl Acad Sci USA 100: 1226–1231, 2003.
Crossref | PubMed | ISI | Google Scholar - 6 Fujioka D, Kawabata K, Saito Y, Kobayashi T, Nakamura T, Kodama Y, Takano H, Obata JE, Kitta Y, Umetani K, Kugiyama K. Role of adiponectin receptors in endothelin-induced cellular hypertrophy in cultured cardiomyocytes and their expression in infarcted heart. Am J Physiol Heart Circ Physiol 290: H2409–H2416, 2006.
Link | ISI | Google Scholar - 7 Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O, Makishima M, Matsuda M, Shimomura I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest 114: 1752–1761, 2004.
Crossref | PubMed | ISI | Google Scholar - 8 Jung TW, Lee JY, Shim WS, Kang ES, Kim JS, Ahn CW, Lee HC, Cha BS. Adiponectin protects human neuroblastoma SH-SY5Y cells against acetaldehyde-induced cytotoxicity. Biochem Pharmacol 72: 616–623, 2006.
Crossref | PubMed | ISI | Google Scholar - 9 Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K, Tobe K. Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J Clin Invest 116: 1784–1792, 2006.
Crossref | PubMed | ISI | Google Scholar - 10 Libby P, Aikawa M. Effects of statins in reducing thrombotic risk and modulating plaque vulnerability. Clin Cardiol 26: I11–I14, 2003.
Crossref | PubMed | ISI | Google Scholar - 11 Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani H, Furuyama N, Kondo H, Takahashi M, Arita Y, Komuro R, Ouchi N, Kihara S, Tochino Y, Okutomi K, Horie M, Takeda S, Aoyama T, Funahashi T, Matsuzawa Y. Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med 8: 731–737, 2002.
Crossref | PubMed | ISI | Google Scholar - 12 Matsuzawa Y, Funahashi T, Kihara S, Shimomura I. Adiponectin and metabolic syndrome. Arterioscler Thromb Vasc Biol 24: 29–33, 2004.
Crossref | PubMed | ISI | Google Scholar - 13 Murray AJ, Lygate CA, Cole MA, Carr CA, Radda GK, Neubauer S, Clarke K. Insulin resistance, abnormal energy metabolism and increased ischemic damage in the chronically infarcted rat heart. Cardiovasc Res 71: 149–157, 2006.
Crossref | PubMed | ISI | Google Scholar - 14 Nakamura T, Kodama Y, Takano H, Umetani K, Fujioka D, Saito Y, Kawabata KI, Obata JE, Kitta Y, Kobayashi T, Mende A, Kugiyama K. Increase in circulating levels of adiponectin after treatment with statin and fibrate in patients with coronary artery disease and hyperlipidemia. Atherosclerosis 193: 449–451, 2006.
PubMed | ISI | Google Scholar - 15 Nikolaidis LA, Sturzu A, Stolarski C, Elahi D, Shen YT, Shannon RP. The development of myocardial insulin resistance in conscious dogs with advanced dilated cardiomyopathy. Cardiovasc Res 61: 297–306, 2004.
Crossref | PubMed | ISI | Google Scholar - 16 Palanivel R, Fang X, Park M, Eguchi M, Pallan S, De Girolamo S, Liu Y, Wang Y, Xu A, Sweeney G. Globular and full-length forms of adiponectin mediate specific changes in glucose and fatty acid uptake and metabolism in cardiomyocytes. Cardiovasc Res 75: 148–157, 2007.
Crossref | PubMed | ISI | Google Scholar - 17 Pischon T, Girman CJ, Hotamisligil GS, Rifai N, Hu FB, Rimm EB. Plasma adiponectin levels and risk of myocardial infarction in men. JAMA 291: 1730–1737, 2004.
Crossref | PubMed | ISI | Google Scholar - 18 Ray KK, Cannon CP. Intensive statin therapy in acute coronary syndromes: clinical benefits and vascular biology. Curr Opin Lipidol 15: 637–643, 2004.
Crossref | PubMed | ISI | Google Scholar - 19 Shibata R, Sato K, Pimentel DR, Takemura Y, Kihara S, Ohashi K, Funahashi T, Ouchi N, Walsh K. Adiponectin protects against myocardial ischemia-reperfusion injury through AMPK- and COX-2-dependent mechanisms. Nat Med 11: 1096–1103, 2005.
Crossref | PubMed | ISI | Google Scholar - 20 Stanley WC, Recchia FA, Lopaschuk GD. Myocardial substrate metabolism in the normal and failing heart. Physiol Rev 85: 1093–1129, 2005.
Link | ISI | Google Scholar - 21 Taegtmeyer H. Cardiac metabolism as a target for the treatment of heart failure. Circulation 110: 894–896, 2004.
Crossref | PubMed | ISI | Google Scholar - 22 Takemura Y, Ouchi N, Shibata R, Aprahamian T, Kirber MT, Summer RS, Kihara S, Walsh K. Adiponectin modulates inflammatory reactions via calreticulin receptor-dependent clearance of early apoptotic bodies. J Clin Invest 117: 375–386, 2007.
Crossref | PubMed | ISI | Google Scholar - 23 Tao L, Gao E, Jiao X, Yuan Y, Li S, Christopher TA, Lopez BL, Koch W, Chan L, Goldstein BJ, Ma XL. Adiponectin cardioprotection after myocardial ischemia/reperfusion involves the reduction of oxidative/nitrative stress. Circulation 115: 1408–1416, 2007.
Crossref | PubMed | ISI | Google Scholar - 24 Valgimigli M, Merli E, Malagutti P, Soukhomovskaia O, Cicchitelli G, Antelli A, Canistro D, Francolini G, Macri G, Mastrorilli F, Paolini M, Ferrari R. Hydroxyl radical generation, levels of tumor necrosis factor-alpha, and progression to heart failure after acute myocardial infarction. J Am Coll Cardiol 43: 2000–2008, 2004.
Crossref | PubMed | ISI | Google Scholar - 25 Wolfrum S, Jensen KS, Liao JK. Endothelium-dependent effects of statins. Arterioscler Thromb 23: 729–736, 2003.
Crossref | Google Scholar - 26 Wong V, Stavar L, Szeto L, Uffelman K, Wang CH, Fantus IG, Lewis GF. Atorvastatin induces insulin sensitization in Zucker lean and fatty rats. Atherosclerosis 184: 348–355, 2006.
Crossref | PubMed | ISI | Google Scholar - 27 Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423: 762–769, 2003.
Crossref | PubMed | ISI | Google Scholar - 28 Yamauchi T, Nio Y, Maki T, Kobayashi M, Takazawa T, Iwabu M, Okada-Iwabu M, Kawamoto S, Kubota N, Kubota T, Ito Y, Kamon J, Tsuchida A, Kumagai K, Kozono H, Hada Y, Ogata H, Tokuyama K, Tsunoda M, Ide T, Murakami K, Awazawa M, Takamoto I, Froguel P, Hara K, Tobe K, Nagai R, Ueki K, Kadowaki T. Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat Med 13: 332–339, 2007.
Crossref | PubMed | ISI | Google Scholar - 29 Yue TL, Bao W, Gu JL, Cui J, Tao L, Ma XL, Ohlstein EH, Jucker BM. Rosiglitazone treatment in Zucker diabetic fatty rats is associated with ameliorated cardiac insulin resistance and protection from ischemia/reperfusion-induced myocardial injury. Diabetes 54: 554–562, 2005.
Crossref | PubMed | ISI | Google Scholar

